Symbol:
Mtfr1
Name:
mitochondrial fission regulator 1
RGD ID:
1304936
Description:
Predicted to be involved in aerobic respiration and mitochondrial fission. Predicted to be located in cytosol and plasma membrane. Predicted to be active in mitochondrion. Orthologous to human MTFR1 (mitochondrial fission regulator 1); INTERACTS WITH 2,6-dinitrotoluene; 3H-1,2-dithiole-3-thione; 4,4'-diaminodiphenylmethane.
Type:
protein-coding
RefSeq Status:
VALIDATED
Previously known as:
LOC311403; RGD1304936; similar to RIKEN cDNA 1300002C08 gene
RGD Orthologs
Alliance Orthologs
More Info
more info ...
More Info
Latest Assembly:
GRCr8 - GRCr8 Assembly
Position:
Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 2 103,594,458 - 103,629,697 (+) NCBI GRCr8 mRatBN7.2 2 101,678,331 - 101,713,547 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 2 101,679,265 - 101,713,544 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 2 108,196,295 - 108,230,638 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 2 106,317,417 - 106,351,754 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 2 101,292,516 - 101,326,813 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 2 104,005,696 - 104,040,914 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 2 104,020,955 - 104,039,198 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 2 123,727,716 - 123,762,927 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 2 104,315,054 - 104,333,297 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 2 104,245,758 - 104,278,219 (+) NCBI Celera 2 97,087,548 - 97,105,789 (+) NCBI Celera Cytogenetic Map 2 q24 NCBI
JBrowse:
View Region in Genome Browser (JBrowse)
Model
Only show annotations with direct experimental evidence (0 objects hidden)
Mtfr1 Rat 1,2-dimethylhydrazine multiple interactions ISO Mtfr1 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of MTFR1 mRNA CTD PMID:22206623 Mtfr1 Rat 1,2-dimethylhydrazine decreases expression ISO Mtfr1 (Mus musculus) 6480464 1 and 2-Dimethylhydrazine results in decreased expression of MTFR1 mRNA CTD PMID:22206623 Mtfr1 Rat 17beta-estradiol decreases expression ISO Mtfr1 (Mus musculus) 6480464 Estradiol results in decreased expression of MTFR1 mRNA CTD PMID:39298647 Mtfr1 Rat 17beta-estradiol decreases expression ISO MTFR1 (Homo sapiens) 6480464 Estradiol results in decreased expression of MTFR1 protein CTD PMID:33181973 Mtfr1 Rat 2,3',4,4',5-Pentachlorobiphenyl increases expression ISO Mtfr1 (Mus musculus) 6480464 2 more ... CTD PMID:31388691 Mtfr1 Rat 2,3,7,8-tetrachlorodibenzodioxine decreases expression ISO MTFR1 (Homo sapiens) 6480464 Tetrachlorodibenzodioxin results in decreased expression of MTFR1 mRNA CTD PMID:20106945 and PMID:21632981 Mtfr1 Rat 2,3,7,8-tetrachlorodibenzodioxine affects expression ISO Mtfr1 (Mus musculus) 6480464 Tetrachlorodibenzodioxin affects the expression of MTFR1 mRNA CTD PMID:21570461 Mtfr1 Rat 2,6-dinitrotoluene affects expression EXP 6480464 2 and 6-dinitrotoluene affects the expression of MTFR1 mRNA CTD PMID:21346803 Mtfr1 Rat 2-palmitoylglycerol increases expression ISO MTFR1 (Homo sapiens) 6480464 2-palmitoylglycerol results in increased expression of MTFR1 mRNA CTD PMID:37199045 Mtfr1 Rat 3,4-methylenedioxymethamphetamine decreases expression ISO Mtfr1 (Mus musculus) 6480464 N-Methyl-3 and 4-methylenedioxyamphetamine results in decreased expression of MTFR1 mRNA CTD PMID:26251327 Mtfr1 Rat 3H-1,2-dithiole-3-thione decreases expression EXP 6480464 1 and 2-dithiol-3-thione results in decreased expression of MTFR1 mRNA CTD PMID:19162173 Mtfr1 Rat 4,4'-diaminodiphenylmethane decreases expression EXP 6480464 4 and 4'-diaminodiphenylmethane results in decreased expression of MTFR1 mRNA CTD PMID:30723492 Mtfr1 Rat 5-aza-2'-deoxycytidine affects expression ISO MTFR1 (Homo sapiens) 6480464 Decitabine affects the expression of MTFR1 mRNA CTD PMID:23300844 Mtfr1 Rat 6-propyl-2-thiouracil decreases expression EXP 6480464 Propylthiouracil results in decreased expression of MTFR1 mRNA CTD PMID:24780913 Mtfr1 Rat acetamide decreases expression EXP 6480464 acetamide results in decreased expression of MTFR1 mRNA CTD PMID:31881176 Mtfr1 Rat acrolein multiple interactions ISO MTFR1 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of MTFR1 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of MTFR1 mRNA CTD PMID:32699268 Mtfr1 Rat aflatoxin B1 increases methylation ISO MTFR1 (Homo sapiens) 6480464 Aflatoxin B1 results in increased methylation of MTFR1 gene CTD PMID:27153756 Mtfr1 Rat all-trans-retinoic acid decreases expression ISO MTFR1 (Homo sapiens) 6480464 Tretinoin results in decreased expression of MTFR1 mRNA CTD PMID:23724009 and PMID:33167477 Mtfr1 Rat alpha-pinene multiple interactions ISO MTFR1 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of MTFR1 mRNA and [Air Pollutants results in increased abundance of [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone]] which results in increased oxidation of MTFR1 mRNA CTD PMID:32699268 Mtfr1 Rat antirheumatic drug increases expression ISO MTFR1 (Homo sapiens) 6480464 Antirheumatic Agents results in increased expression of MTFR1 mRNA CTD PMID:24449571 Mtfr1 Rat Aroclor 1254 decreases expression ISO Mtfr1 (Mus musculus) 6480464 Chlorodiphenyl (54% Chlorine) results in decreased expression of MTFR1 mRNA CTD PMID:23650126 Mtfr1 Rat arsane multiple interactions ISO MTFR1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of MTFR1 mRNA CTD PMID:39836092 Mtfr1 Rat arsenic atom multiple interactions ISO MTFR1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of MTFR1 mRNA CTD PMID:39836092 Mtfr1 Rat arsenite(3-) multiple interactions ISO MTFR1 (Homo sapiens) 6480464 arsenite promotes the reaction [G3BP1 protein binds to MTFR1 mRNA] CTD PMID:32406909 Mtfr1 Rat atrazine increases expression ISO MTFR1 (Homo sapiens) 6480464 Atrazine results in increased expression of MTFR1 mRNA CTD PMID:22378314 Mtfr1 Rat benzo[a]pyrene increases expression ISO Mtfr1 (Mus musculus) 6480464 Benzo(a)pyrene results in increased expression of MTFR1 mRNA CTD PMID:26496743 Mtfr1 Rat benzo[a]pyrene decreases methylation ISO MTFR1 (Homo sapiens) 6480464 Benzo(a)pyrene results in decreased methylation of MTFR1 5' UTR CTD PMID:27901495 Mtfr1 Rat benzo[a]pyrene diol epoxide I decreases expression ISO MTFR1 (Homo sapiens) 6480464 7 more ... CTD PMID:20018196 Mtfr1 Rat benzo[e]pyrene increases methylation ISO MTFR1 (Homo sapiens) 6480464 benzo(e)pyrene results in increased methylation of MTFR1 intron CTD PMID:30157460 Mtfr1 Rat beta-lapachone decreases expression ISO MTFR1 (Homo sapiens) 6480464 beta-lapachone results in decreased expression of MTFR1 mRNA CTD PMID:38218311 Mtfr1 Rat beta-lapachone increases expression ISO MTFR1 (Homo sapiens) 6480464 beta-lapachone results in increased expression of MTFR1 mRNA CTD PMID:38218311 Mtfr1 Rat bisphenol A decreases expression EXP 6480464 bisphenol A results in decreased expression of MTFR1 mRNA CTD PMID:25181051 Mtfr1 Rat bisphenol A decreases expression ISO MTFR1 (Homo sapiens) 6480464 bisphenol A results in decreased expression of MTFR1 protein CTD PMID:33181973 Mtfr1 Rat bisphenol A increases expression EXP 6480464 bisphenol A results in increased expression of MTFR1 mRNA CTD PMID:30816183 and PMID:32145629 Mtfr1 Rat bisphenol F increases expression ISO Mtfr1 (Mus musculus) 6480464 bisphenol F results in increased expression of MTFR1 mRNA CTD PMID:38685157 Mtfr1 Rat chrysene decreases expression ISO Mtfr1 (Mus musculus) 6480464 chrysene results in decreased expression of MTFR1 mRNA CTD PMID:26377693 Mtfr1 Rat cisplatin affects expression ISO MTFR1 (Homo sapiens) 6480464 Cisplatin affects the expression of MTFR1 mRNA CTD PMID:23300844 Mtfr1 Rat cobalt dichloride increases expression ISO Mtfr1 (Mus musculus) 6480464 cobaltous chloride results in increased expression of MTFR1 mRNA CTD PMID:21139344 Mtfr1 Rat corosolic acid decreases expression ISO MTFR1 (Homo sapiens) 6480464 corosolic acid results in decreased expression of MTFR1 mRNA CTD PMID:37939859 Mtfr1 Rat cyclosporin A increases expression ISO MTFR1 (Homo sapiens) 6480464 Cyclosporine results in increased expression of MTFR1 mRNA CTD PMID:20106945 more ... Mtfr1 Rat Dibutyl phosphate affects expression ISO MTFR1 (Homo sapiens) 6480464 di-n-butylphosphoric acid affects the expression of MTFR1 mRNA CTD PMID:37042841 Mtfr1 Rat diuron increases expression EXP 6480464 Diuron results in increased expression of MTFR1 mRNA CTD PMID:21551480 Mtfr1 Rat doxorubicin decreases expression ISO MTFR1 (Homo sapiens) 6480464 Doxorubicin results in decreased expression of MTFR1 mRNA CTD PMID:29803840 Mtfr1 Rat epoxiconazole decreases expression ISO Mtfr1 (Mus musculus) 6480464 epoxiconazole results in decreased expression of MTFR1 mRNA CTD PMID:35436446 Mtfr1 Rat ethyl methanesulfonate decreases expression ISO MTFR1 (Homo sapiens) 6480464 Ethyl Methanesulfonate results in decreased expression of MTFR1 mRNA CTD PMID:23649840 Mtfr1 Rat fluoxetine increases expression ISO MTFR1 (Homo sapiens) 6480464 Fluoxetine results in increased expression of MTFR1 mRNA CTD PMID:37386098 Mtfr1 Rat folic acid multiple interactions ISO Mtfr1 (Mus musculus) 6480464 [1 and 2-Dimethylhydrazine co-treated with Folic Acid] results in decreased expression of MTFR1 mRNA CTD PMID:22206623 Mtfr1 Rat formaldehyde decreases expression ISO MTFR1 (Homo sapiens) 6480464 Formaldehyde results in decreased expression of MTFR1 mRNA CTD PMID:23649840 Mtfr1 Rat FR900359 increases phosphorylation ISO MTFR1 (Homo sapiens) 6480464 FR900359 results in increased phosphorylation of MTFR1 protein CTD PMID:37730182 Mtfr1 Rat gentamycin increases expression EXP 6480464 Gentamicins results in increased expression of MTFR1 mRNA CTD PMID:33387578 Mtfr1 Rat lead(0) affects expression ISO MTFR1 (Homo sapiens) 6480464 Lead affects the expression of MTFR1 mRNA CTD PMID:28903495 Mtfr1 Rat linsidomine increases oxidation EXP 6480464 linsidomine results in increased oxidation of MTFR1 protein CTD PMID:28086193 Mtfr1 Rat manganese atom multiple interactions ISO MTFR1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of MTFR1 mRNA CTD PMID:39836092 Mtfr1 Rat manganese(0) multiple interactions ISO MTFR1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of MTFR1 mRNA CTD PMID:39836092 Mtfr1 Rat manganese(II) chloride multiple interactions ISO MTFR1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of MTFR1 mRNA CTD PMID:39836092 Mtfr1 Rat methapyrilene increases methylation ISO MTFR1 (Homo sapiens) 6480464 Methapyrilene results in increased methylation of MTFR1 intron CTD PMID:30157460 Mtfr1 Rat oxaliplatin multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in decreased expression of MTFR1 mRNA CTD PMID:25729387 Mtfr1 Rat oxaliplatin decreases expression EXP 6480464 oxaliplatin results in decreased expression of MTFR1 mRNA CTD PMID:25729387 Mtfr1 Rat ozone multiple interactions ISO MTFR1 (Homo sapiens) 6480464 [Acrolein co-treated with methacrylaldehyde co-treated with alpha-pinene co-treated with Ozone] results in increased oxidation of MTFR1 mRNA more ... CTD PMID:32699268 Mtfr1 Rat paracetamol increases expression EXP 6480464 Acetaminophen results in increased expression of MTFR1 mRNA CTD PMID:33387578 Mtfr1 Rat picoxystrobin increases expression ISO MTFR1 (Homo sapiens) 6480464 picoxystrobin results in increased expression of MTFR1 mRNA CTD PMID:33512557 Mtfr1 Rat pirinixic acid increases expression ISO Mtfr1 (Mus musculus) 6480464 pirinixic acid results in increased expression of MTFR1 mRNA CTD PMID:17426115 Mtfr1 Rat quercetin decreases expression ISO MTFR1 (Homo sapiens) 6480464 Quercetin results in decreased expression of MTFR1 mRNA CTD PMID:21632981 Mtfr1 Rat quercetin decreases phosphorylation ISO MTFR1 (Homo sapiens) 6480464 Quercetin results in decreased phosphorylation of MTFR1 protein CTD PMID:35688186 Mtfr1 Rat rotenone increases expression ISO MTFR1 (Homo sapiens) 6480464 Rotenone results in increased expression of MTFR1 mRNA CTD PMID:33512557 Mtfr1 Rat sodium arsenite multiple interactions ISO MTFR1 (Homo sapiens) 6480464 [[sodium arsenite results in increased abundance of Arsenic] co-treated with [manganese chloride results in increased abundance of Manganese]] results in increased expression of MTFR1 mRNA CTD PMID:39836092 Mtfr1 Rat sulindac sulfide increases expression ISO MTFR1 (Homo sapiens) 6480464 sulindac sulfide results in increased expression of MTFR1 mRNA CTD PMID:16184548 Mtfr1 Rat sunitinib increases expression ISO MTFR1 (Homo sapiens) 6480464 Sunitinib results in increased expression of MTFR1 mRNA CTD PMID:31533062 Mtfr1 Rat thapsigargin increases expression ISO MTFR1 (Homo sapiens) 6480464 Thapsigargin results in increased expression of MTFR1 mRNA CTD PMID:22378314 Mtfr1 Rat titanium dioxide decreases methylation ISO Mtfr1 (Mus musculus) 6480464 titanium dioxide results in decreased methylation of MTFR1 gene CTD PMID:35295148 Mtfr1 Rat topotecan decreases expression EXP 6480464 Topotecan results in decreased expression of MTFR1 mRNA CTD PMID:25729387 Mtfr1 Rat topotecan multiple interactions EXP 6480464 [oxaliplatin co-treated with Topotecan] results in decreased expression of MTFR1 mRNA CTD PMID:25729387 Mtfr1 Rat triphenyl phosphate affects expression ISO MTFR1 (Homo sapiens) 6480464 triphenyl phosphate affects the expression of MTFR1 mRNA CTD PMID:37042841 Mtfr1 Rat triptonide increases expression ISO Mtfr1 (Mus musculus) 6480464 triptonide results in increased expression of MTFR1 mRNA CTD PMID:33045310 Mtfr1 Rat tunicamycin increases expression ISO MTFR1 (Homo sapiens) 6480464 Tunicamycin results in increased expression of MTFR1 mRNA CTD PMID:22378314 Mtfr1 Rat valproic acid increases expression ISO MTFR1 (Homo sapiens) 6480464 Valproic Acid results in increased expression of MTFR1 mRNA CTD PMID:19101580 more ... Mtfr1 Rat valproic acid affects expression ISO MTFR1 (Homo sapiens) 6480464 Valproic Acid affects the expression of MTFR1 mRNA CTD PMID:25979313 Mtfr1 Rat vitamin E decreases expression ISO MTFR1 (Homo sapiens) 6480464 Vitamin E results in decreased expression of MTFR1 mRNA CTD PMID:19244175
1,2-dimethylhydrazine (ISO) 17beta-estradiol (ISO) 2,3',4,4',5-Pentachlorobiphenyl (ISO) 2,3,7,8-tetrachlorodibenzodioxine (ISO) 2,6-dinitrotoluene (EXP) 2-palmitoylglycerol (ISO) 3,4-methylenedioxymethamphetamine (ISO) 3H-1,2-dithiole-3-thione (EXP) 4,4'-diaminodiphenylmethane (EXP) 5-aza-2'-deoxycytidine (ISO) 6-propyl-2-thiouracil (EXP) acetamide (EXP) acrolein (ISO) aflatoxin B1 (ISO) all-trans-retinoic acid (ISO) alpha-pinene (ISO) antirheumatic drug (ISO) Aroclor 1254 (ISO) arsane (ISO) arsenic atom (ISO) arsenite(3-) (ISO) atrazine (ISO) benzo[a]pyrene (ISO) benzo[a]pyrene diol epoxide I (ISO) benzo[e]pyrene (ISO) beta-lapachone (ISO) bisphenol A (EXP,ISO) bisphenol F (ISO) chrysene (ISO) cisplatin (ISO) cobalt dichloride (ISO) corosolic acid (ISO) cyclosporin A (ISO) Dibutyl phosphate (ISO) diuron (EXP) doxorubicin (ISO) epoxiconazole (ISO) ethyl methanesulfonate (ISO) fluoxetine (ISO) folic acid (ISO) formaldehyde (ISO) FR900359 (ISO) gentamycin (EXP) lead(0) (ISO) linsidomine (EXP) manganese atom (ISO) manganese(0) (ISO) manganese(II) chloride (ISO) methapyrilene (ISO) oxaliplatin (EXP) ozone (ISO) paracetamol (EXP) picoxystrobin (ISO) pirinixic acid (ISO) quercetin (ISO) rotenone (ISO) sodium arsenite (ISO) sulindac sulfide (ISO) sunitinib (ISO) thapsigargin (ISO) titanium dioxide (ISO) topotecan (EXP) triphenyl phosphate (ISO) triptonide (ISO) tunicamycin (ISO) valproic acid (ISO) vitamin E (ISO)
Mtfr1 Rat Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCr8 2 103,594,458 - 103,629,697 (+) NCBI GRCr8 mRatBN7.2 2 101,678,331 - 101,713,547 (+) NCBI mRatBN7.2 mRatBN7.2 mRatBN7.2 Ensembl 2 101,679,265 - 101,713,544 (+) Ensembl mRatBN7.2 Ensembl UTH_Rnor_SHR_Utx 2 108,196,295 - 108,230,638 (+) NCBI Rnor_SHR UTH_Rnor_SHR_Utx UTH_Rnor_SHRSP_BbbUtx_1.0 2 106,317,417 - 106,351,754 (+) NCBI Rnor_SHRSP UTH_Rnor_SHRSP_BbbUtx_1.0 UTH_Rnor_WKY_Bbb_1.0 2 101,292,516 - 101,326,813 (+) NCBI Rnor_WKY UTH_Rnor_WKY_Bbb_1.0 Rnor_6.0 2 104,005,696 - 104,040,914 (+) NCBI Rnor6.0 Rnor_6.0 rn6 Rnor6.0 Rnor_6.0 Ensembl 2 104,020,955 - 104,039,198 (+) Ensembl Rnor6.0 rn6 Rnor6.0 Rnor_5.0 2 123,727,716 - 123,762,927 (+) NCBI Rnor5.0 Rnor_5.0 rn5 Rnor5.0 RGSC_v3.4 2 104,315,054 - 104,333,297 (+) NCBI RGSC3.4 RGSC_v3.4 rn4 RGSC3.4 RGSC_v3.1 2 104,245,758 - 104,278,219 (+) NCBI Celera 2 97,087,548 - 97,105,789 (+) NCBI Celera Cytogenetic Map 2 q24 NCBI
MTFR1 Human Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCh38 8 65,643,889 - 65,778,598 (+) NCBI GRCh38 GRCh38 hg38 GRCh38 GRCh38.p14 Ensembl 8 65,644,734 - 65,771,261 (+) Ensembl GRCh38 hg38 GRCh38 GRCh37 8 66,556,124 - 66,659,848 (+) NCBI GRCh37 GRCh37 hg19 GRCh37 Build 36 8 66,719,528 - 66,785,340 (+) NCBI NCBI36 Build 36 hg18 NCBI36 Celera 8 62,548,374 - 62,614,202 (+) NCBI Celera Cytogenetic Map 8 q13.1 NCBI HuRef 8 62,046,952 - 62,112,914 (+) NCBI HuRef CHM1_1 8 66,611,523 - 66,677,456 (+) NCBI CHM1_1 T2T-CHM13v2.0 8 66,069,548 - 66,197,575 (+) NCBI T2T-CHM13v2.0
Mtfr1 Mouse Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl GRCm39 3 19,241,481 - 19,274,981 (+) NCBI GRCm39 GRCm39 mm39 GRCm39 Ensembl 3 19,241,491 - 19,274,981 (+) Ensembl GRCm39 Ensembl GRCm38 3 19,187,315 - 19,220,817 (+) NCBI GRCm38 GRCm38 mm10 GRCm38 GRCm38.p6 Ensembl 3 19,187,327 - 19,220,817 (+) Ensembl GRCm38 mm10 GRCm38 MGSCv37 3 19,088,244 - 19,120,805 (+) NCBI GRCm37 MGSCv37 mm9 NCBIm37 MGSCv36 3 19,380,395 - 19,412,956 (+) NCBI MGSCv36 mm8 Celera 3 19,178,811 - 19,211,401 (+) NCBI Celera Cytogenetic Map 3 A2 NCBI cM Map 3 5.36 NCBI
Mtfr1 Chinchilla Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChiLan1.0 NW_004955444 13,481,270 - 13,520,673 (-) NCBI ChiLan1.0 ChiLan1.0
MTFR1 Bonobo Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl NHGRI_mPanPan1-v2 7 81,376,429 - 81,504,541 (+) NCBI NHGRI_mPanPan1-v2 NHGRI_mPanPan1 8 57,015,953 - 57,144,072 (+) NCBI NHGRI_mPanPan1 Mhudiblu_PPA_v0 8 62,184,249 - 62,265,239 (+) NCBI Mhudiblu_PPA_v0 Mhudiblu_PPA_v0 panPan3 PanPan1.1 8 63,853,159 - 63,933,929 (+) NCBI panpan1.1 PanPan1.1 panPan2 PanPan1.1 Ensembl 8 63,853,944 - 63,933,929 (+) Ensembl panpan1.1 panPan2
MTFR1 Dog Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl CanFam3.1 29 15,314,955 - 15,390,776 (+) NCBI CanFam3.1 CanFam3.1 canFam3 CanFam3.1 CanFam3.1 Ensembl 29 15,315,069 - 15,389,458 (+) Ensembl CanFam3.1 canFam3 CanFam3.1 Dog10K_Boxer_Tasha 29 15,636,884 - 15,712,602 (+) NCBI Dog10K_Boxer_Tasha ROS_Cfam_1.0 29 15,400,018 - 15,476,023 (+) NCBI ROS_Cfam_1.0 ROS_Cfam_1.0 Ensembl 29 15,399,872 - 15,476,025 (+) Ensembl ROS_Cfam_1.0 Ensembl UMICH_Zoey_3.1 29 15,417,446 - 15,493,336 (+) NCBI UMICH_Zoey_3.1 UNSW_CanFamBas_1.0 29 15,532,588 - 15,608,322 (+) NCBI UNSW_CanFamBas_1.0 UU_Cfam_GSD_1.0 29 15,793,667 - 15,869,490 (+) NCBI UU_Cfam_GSD_1.0
Mtfr1 Squirrel Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl HiC_Itri_2 NW_024405303 66,561,693 - 66,614,240 (+) NCBI HiC_Itri_2 SpeTri2.0 Ensembl NW_004936496 8,170,116 - 8,224,482 (-) Ensembl SpeTri2.0 SpeTri2.0 Ensembl SpeTri2.0 NW_004936496 8,171,020 - 8,223,712 (-) NCBI SpeTri2.0 SpeTri2.0 SpeTri2.0
MTFR1 Pig Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl Sscrofa11.1 Ensembl 4 68,902,857 - 68,969,615 (-) Ensembl Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa11.1 4 68,902,854 - 68,969,998 (-) NCBI Sscrofa11.1 Sscrofa11.1 susScr11 Sscrofa11.1 Sscrofa10.2 4 75,061,582 - 75,128,846 (-) NCBI Sscrofa10.2 Sscrofa10.2 susScr3
MTFR1 Green Monkey Assembly Chr Position (strand) Source Genome Browsers JBrowse NCBI UCSC Ensembl ChlSab1.1 8 61,507,898 - 61,594,433 (+) NCBI ChlSab1.1 ChlSab1.1 chlSab2 ChlSab1.1 Ensembl 8 61,507,971 - 61,594,221 (+) Ensembl ChlSab1.1 ChlSab1.1 Ensembl chlSab2 Vero_WHO_p1.0 NW_023666039 79,923,061 - 80,013,576 (-) NCBI Vero_WHO_p1.0 Vero_WHO_p1.0
Mtfr1
.
Predicted Target Of
Count of predictions: 133 Count of miRNA genes: 107 Interacting mature miRNAs: 116 Transcripts: ENSRNOT00000045586 Prediction methods: Microtar, Miranda, Rnahybrid, Targetscan Result types: miRGate_prediction
1578777 Stresp15 Stress response QTL 15 2 0.05 blood aldosterone amount (VT:0005346) plasma aldosterone level (CMO:0000551) 2 59846005 104846005 Rat 2293671 Bss44 Bone structure and strength QTL 44 10.97 0.0001 lumbar vertebra morphology trait (VT:0010494) lumbar vertebra cortical cross-sectional area (CMO:0001690) 2 43162366 148478373 Rat 1298074 Bp164 Blood pressure QTL 164 0.003 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 42804607 202447032 Rat 1598865 Bp296 Blood pressure QTL 296 2.1 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 81018907 126018907 Rat 1354648 Bp239 Blood pressure QTL 239 0.001 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 66118463 226797303 Rat 1578772 Stresp14 Stress response QTL 14 5 0.001 blood renin amount (VT:0003349) plasma renin activity level (CMO:0000116) 2 82345893 130923501 Rat 1354649 Kidm17 Kidney mass QTL 17 2.9 kidney mass (VT:0002707) calculated kidney weight (CMO:0000160) 2 81754530 227146641 Rat 2293676 Bmd19 Bone mineral density QTL 19 10.7 0.0001 femur mineral mass (VT:0010011) total volumetric bone mineral density (CMO:0001728) 2 43162366 111362592 Rat 10755499 Bp389 Blood pressure QTL 389 2.61 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 2 18960362 228801039 Rat 2293682 Bmd24 Bone mineral density QTL 24 8.9 0.0001 femur mineral mass (VT:0010011) compact volumetric bone mineral density (CMO:0001730) 2 43162366 111362592 Rat 152025242 Bw191 Body weight QTL 191 3.62 body mass (VT:0001259) 2 38573329 122609194 Rat 1598862 Glom9 Glomerulus QTL 9 3.5 kidney glomerulus morphology trait (VT:0005325) index of glomerular damage (CMO:0001135) 2 92337601 137337601 Rat 631198 Cm22 Cardiac mass QTL 22 4.3 0.0008 heart left ventricle mass (VT:0007031) heart left ventricle weight to body weight ratio (CMO:0000530) 2 76539322 150540526 Rat 1598863 Cm65 Cardiac mass QTL 65 2.3 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 2 92337601 137337601 Rat 1302794 Stl27 Serum triglyceride level QTL 27 4.4 0.0001 blood triglyceride amount (VT:0002644) plasma triglyceride level (CMO:0000548) 2 25413423 143657569 Rat 61465 Bp13 Blood pressure QTL 13 3.3 blood pressure trait (VT:0000183) systolic blood pressure (CMO:0000004) 2 76539322 102785628 Rat 1581569 Uae32 Urinary albumin excretion QTL 32 0.0001 urine protein amount (VT:0005160) urine albumin excretion rate (CMO:0000757) 2 78665619 219826953 Rat 61467 Bp14 Blood pressure QTL 14 2.2 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 43154682 202446871 Rat 70174 BpQTLCluster2 Blood pressure QTL cluster 2 4.24 arterial blood pressure trait (VT:2000000) absolute change in mean arterial blood pressure (CMO:0000533) 2 40067944 102785628 Rat 1358901 Cm38 Cardiac mass QTL 38 2 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 2 25413423 157142209 Rat 1331760 Bp206 Blood pressure QTL 206 3.62454 arterial blood pressure trait (VT:2000000) mean arterial blood pressure (CMO:0000009) 2 56043031 202447032 Rat 2300165 Bmd49 Bone mineral density QTL 49 4.8 0.0001 lumbar vertebra mineral mass (VT:0010511) bone mineral density (CMO:0001226) 2 88862519 133862519 Rat 1358899 Kidm23 Kidney mass QTL 23 3.88 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 2 25413423 157142209 Rat 1358908 Bw49 Body weight QTL 49 3.36 body mass (VT:0001259) body weight (CMO:0000012) 2 25413652 157142078 Rat 5684990 Bmd82 Bone mineral density QTL 82 2.8 tibia mineral mass (VT:1000283) bone mineral content (CMO:0001554) 2 59324377 103795077 Rat 2300170 Bmd45 Bone mineral density QTL 45 12.1 0.0001 lumbar vertebra mineral mass (VT:0010511) volumetric bone mineral density (CMO:0001553) 2 88862519 133862519 Rat 1358910 Kidm27 Kidney mass QTL 27 5.77 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 2 25413423 157142209 Rat 61355 Bp36 Blood pressure QTL 36 2.9 blood pressure trait (VT:0000183) systolic blood pressure (CMO:0000004) 2 5873687 102844969 Rat 1358911 Kidm28 Kidney mass QTL 28 5.42 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 2 25413423 157142209 Rat 1358904 Cm39 Cardiac mass QTL 39 2.26 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 2 25413423 157142209 Rat 7411551 Bw131 Body weight QTL 131 29.6 0.001 body mass (VT:0001259) body weight gain (CMO:0000420) 2 67942638 112942638 Rat 1358887 Bw50 Body weight QTL 50 2.39 body mass (VT:0001259) body weight (CMO:0000012) 2 25413652 157142078 Rat 1298080 Bp163 Blood pressure QTL 163 0.02 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 66118275 202447032 Rat 8662832 Vetf7 Vascular elastic tissue fragility QTL 7 3.5 aorta elastin amount (VT:0003905) aorta wall extracellular elastin dry weight to aorta wall dry weight ratio (CMO:0002002) 2 81689826 221035911 Rat 1298085 Bp165 Blood pressure QTL 165 0.0006 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 42804607 202447032 Rat 2290453 Scl55 Serum cholesterol level QTL 55 2.83 blood cholesterol amount (VT:0000180) plasma total cholesterol level (CMO:0000585) 2 26917817 136917119 Rat 2299162 Iddm32 Insulin dependent diabetes mellitus QTL 32 2.36 blood glucose amount (VT:0000188) age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140) 2 78665616 143657569 Rat 1358894 Kidm24 Kidney mass QTL 24 4.03 kidney mass (VT:0002707) both kidneys wet weight to body weight ratio (CMO:0000340) 2 25413423 157142209 Rat 2300185 Bmd46 Bone mineral density QTL 46 8.4 0.0001 femur mineral mass (VT:0010011) volumetric bone mineral density (CMO:0001553) 2 88862519 133862519 Rat 724534 Uae6 Urinary albumin excretion QTL 6 10 urine albumin amount (VT:0002871) urine albumin level (CMO:0000130) 2 78665619 249053267 Rat 61374 Edpm2 Estrogen-dependent pituitary mass QTL 2 4.42 0.86 pituitary gland mass (VT:0010496) pituitary gland wet weight (CMO:0000853) 2 76539322 202447032 Rat 631500 Bp99 Blood pressure QTL 99 2.5 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 59324719 102755241 Rat 61392 Bp6 Blood pressure QTL 6 7 arterial blood pressure trait (VT:2000000) pulse pressure (CMO:0000292) 2 80270434 125270434 Rat 1358917 Cm42 Cardiac mass QTL 42 2.82 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 2 25413423 203928301 Rat 5684996 Bmd85 Bone mineral density QTL 85 4.7 0.024 tibia mineral mass (VT:1000283) bone mineral density (CMO:0001226) 2 59324377 103795077 Rat 1358913 Cm41 Cardiac mass QTL 41 2.73 heart mass (VT:0007028) heart weight to body weight ratio (CMO:0000074) 2 25413423 203928301 Rat 2293835 Kiddil5 Kidney dilation QTL 5 3.8 kidney pelvis morphology trait (VT:0004194) hydronephrosis severity score (CMO:0001208) 2 42804607 157142209 Rat 1558653 Prcr1 Prostate cancer resistance QTL 1 5 prostate integrity trait (VT:0010571) area of ventral prostate occupied by tumorous lesions to total ventral prostate area ratio (CMO:0000899) 2 72532993 157142209 Rat 1354622 Kidm16 Kidney mass QTL 16 3 kidney mass (VT:0002707) left kidney wet weight (CMO:0000083) 2 81754530 222436696 Rat 631266 Bp132 Blood pressure QTL 132 0.0005 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 46123260 202447032 Rat 7207808 Bmd89 Bone mineral density QTL 89 4.1 femur strength trait (VT:0010010) femoral neck ultimate force (CMO:0001703) 2 88862519 133862519 Rat 1558648 Smcn1 Smooth muscle cell number QTL 1 0.039 blood vessel smooth muscle cell quantity (VT:0010525) aorta smooth muscle cell count per unit vessel length (CMO:0001646) 2 59134147 127460910 Rat 2293843 Kiddil6 Kidney dilation QTL 6 3.1 kidney pelvis morphology trait (VT:0004194) hydronephrosis severity score (CMO:0001208) 2 42804607 182042367 Rat 2306903 Bp336 Blood pressure QTL 336 0.01 arterial blood pressure trait (VT:2000000) systolic blood pressure (CMO:0000004) 2 64366971 109366971 Rat 152025206 Hrtrt23 Heart rate QTL 23 5.98 heart pumping trait (VT:2000009) 2 28484589 169504100 Rat 1354605 Rf48 Renal function QTL 48 2.9 blood creatinine amount (VT:0005328) plasma creatinine level (CMO:0000537) 2 74786664 206665859 Rat 152025204 Hrtrt22 Heart rate QTL 22 5.6 heart pumping trait (VT:2000009) 2 28484589 169504100 Rat 1354601 Slep1 Serum leptin concentration QTL 1 5.39 blood leptin amount (VT:0005667) serum leptin level (CMO:0000780) 2 43171017 184114403 Rat 61438 Cia7 Collagen induced arthritis QTL 7 4.6 0.0001 joint integrity trait (VT:0010548) joint inflammation composite score (CMO:0000919) 2 59324377 141596857 Rat 1354603 Bp243 Blood pressure QTL 243 3.9 arterial blood pressure trait (VT:2000000) diastolic blood pressure (CMO:0000005) 2 26917817 127469484 Rat
RH141233
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 2 101,712,146 - 101,712,334 (+) MAPPER mRatBN7.2 mRatBN7.2 3 114,288,448 - 114,288,636 (+) MAPPER mRatBN7.2 Rnor_6.0 3 119,500,161 - 119,500,348 NCBI Rnor6.0 Rnor_6.0 2 104,039,514 - 104,039,701 NCBI Rnor6.0 Rnor_5.0 3 126,025,998 - 126,026,185 UniSTS Rnor5.0 Rnor_5.0 2 123,761,527 - 123,761,714 UniSTS Rnor5.0 RGSC_v3.4 3 114,565,653 - 114,565,840 UniSTS RGSC3.4 RGSC_v3.4 2 104,333,613 - 104,333,800 UniSTS RGSC3.4 Celera 2 97,106,105 - 97,106,292 UniSTS Celera 3 113,128,494 - 113,128,681 UniSTS Cytogenetic Map 3 q36 UniSTS Cytogenetic Map 2 q24 UniSTS
AA892399
Rat Assembly Chr Position (strand) Source JBrowse mRatBN7.2 2 101,713,223 - 101,713,316 (+) MAPPER mRatBN7.2 Rnor_6.0 2 104,040,591 - 104,040,683 NCBI Rnor6.0 Rnor_5.0 2 123,762,604 - 123,762,696 UniSTS Rnor5.0 RGSC_v3.4 2 104,334,690 - 104,334,782 UniSTS RGSC3.4 Celera 2 97,107,182 - 97,107,274 UniSTS RH 3.4 Map 2 623.2 UniSTS Cytogenetic Map 2 q24 UniSTS
Click on a value in the shaded box below the category label to view a detailed expression data table for that system.
alimentary part of gastrointestinal system
9
11
49
113
91
90
59
25
59
6
218
97
93
45
60
31
Too many to show, limit is 500. Download them if you would like to view them all.
Ensembl Acc Id:
ENSRNOT00000045586 ⟹ ENSRNOP00000040894
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 2 101,679,265 - 101,713,544 (+) Ensembl Rnor_6.0 Ensembl 2 104,020,955 - 104,039,198 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000096493 ⟹ ENSRNOP00000083824
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 2 101,694,083 - 101,713,544 (+) Ensembl
Ensembl Acc Id:
ENSRNOT00000107050 ⟹ ENSRNOP00000086488
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source mRatBN7.2 Ensembl 2 101,698,140 - 101,713,544 (+) Ensembl
RefSeq Acc Id:
NM_001100977 ⟹ NP_001094447
RefSeq Status:
VALIDATED
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 2 103,595,420 - 103,629,697 (+) NCBI mRatBN7.2 2 101,679,265 - 101,713,547 (+) NCBI Rnor_6.0 2 104,020,955 - 104,039,198 (+) NCBI Rnor_5.0 2 123,727,716 - 123,762,927 (+) NCBI RGSC_v3.4 2 104,315,054 - 104,333,297 (+) RGD Celera 2 97,087,548 - 97,105,789 (+) RGD
Sequence:
GAAGACTCAGCCATCTCCATGCTGGGCTGGATTAAGTGCCTGATGAGGATGTGGTTTCAGCGAGTTGGGGTCAGCATGCAGTCGGTTCTGTGGTCTGGAAAACCATATGGTTCATCTCGAAGTATTGT
hide sequence
RefSeq Acc Id:
XM_006232179 ⟹ XP_006232241
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 2 103,594,458 - 103,628,570 (+) NCBI mRatBN7.2 2 101,678,331 - 101,711,831 (+) NCBI Rnor_6.0 2 104,005,696 - 104,040,912 (+) NCBI Rnor_5.0 2 123,727,716 - 123,762,927 (+) NCBI
Sequence:
GATGAAATACTGAAAGCAGTAGTCCGAAGGAATTCAAGCCGTTGGGGCAAGAACACCAGCGCTC
hide sequence
RefSeq Acc Id:
XM_006232180 ⟹ XP_006232242
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 2 103,614,294 - 103,628,570 (+) NCBI mRatBN7.2 2 101,698,168 - 101,713,545 (+) NCBI Rnor_6.0 2 104,024,616 - 104,040,912 (+) NCBI Rnor_5.0 2 123,727,716 - 123,762,927 (+) NCBI
Sequence:
ACACACACAGCCATTGTTGATTATTTATAAGCAGTTTTTGTAGATAATCAGTGCACAGTGTCTC
hide sequence
RefSeq Acc Id:
XM_063281992 ⟹ XP_063138062
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 2 103,615,435 - 103,628,570 (+) NCBI
RefSeq Acc Id:
XM_063281993 ⟹ XP_063138063
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 2 103,594,502 - 103,628,570 (+) NCBI
RefSeq Acc Id:
XM_063281994 ⟹ XP_063138064
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 2 103,595,419 - 103,628,570 (+) NCBI
RefSeq Acc Id:
XM_063281995 ⟹ XP_063138065
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 2 103,595,425 - 103,628,570 (+) NCBI
RefSeq Acc Id:
XM_063281996 ⟹ XP_063138066
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 2 103,594,499 - 103,628,570 (+) NCBI
RefSeq Acc Id:
XM_063281997 ⟹ XP_063138067
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 2 103,594,502 - 103,628,570 (+) NCBI
RefSeq Acc Id:
XM_063281998 ⟹ XP_063138068
Type:
CODING
Position:
Rat Assembly Chr Position (strand) Source GRCr8 2 103,606,554 - 103,628,570 (+) NCBI
RefSeq Acc Id:
NP_001094447 ⟸ NM_001100977
- UniProtKB:
G3V9A7 (UniProtKB/Swiss-Prot), A3F823 (UniProtKB/Swiss-Prot), A0A8I6A026 (UniProtKB/TrEMBL)
- Sequence:
MLGWIKCLMRMWFQRVGVSMQSVLWSGKPYGSSRSIVRKIGTNLSLIQCPRVQFQLTSHATEWSPTHPGEDVVATFADVGWVATDEGECSTRLRTEVRSKPPLENNPPCFEKPPSRHISLPNSSQDKP
hide sequence
RefSeq Acc Id:
XP_006232241 ⟸ XM_006232179
- Peptide Label:
isoform X1
- UniProtKB:
A3F823 (UniProtKB/Swiss-Prot), G3V9A7 (UniProtKB/Swiss-Prot), A0A8I6A026 (UniProtKB/TrEMBL)
- Sequence:
MLGWIKCLMRMWFQRVGVSMQSVLWSGKPYGSSRSIVRKIGTNLSLIQCPRVQFQLTSHATEWSPTHPGEDVVATFADVGWVATDEGECSTRLRTEVRSKPPLENNPPCFEKPPSRHISLPNSSQDKP
hide sequence
RefSeq Acc Id:
XP_006232242 ⟸ XM_006232180
- Peptide Label:
isoform X3
- UniProtKB:
A0A8I6A6A8 (UniProtKB/TrEMBL), A0A8I6A026 (UniProtKB/TrEMBL)
- Sequence:
MYKVLWSGKPYGSSRSIVRKIGTNLSLIQCPRVQFQLTSHATEWSPTHPGEDVVATFADVGWVATDEGECSTRLRTEVRSKPPLENNPPCFEKPPSRHISLPNSSQDKPSPKTTLASEEALQKISALE
hide sequence
Ensembl Acc Id:
ENSRNOP00000040894 ⟸ ENSRNOT00000045586
Ensembl Acc Id:
ENSRNOP00000086488 ⟸ ENSRNOT00000107050
Ensembl Acc Id:
ENSRNOP00000083824 ⟸ ENSRNOT00000096493
RefSeq Acc Id:
XP_063138066 ⟸ XM_063281996
- Peptide Label:
isoform X1
- UniProtKB:
G3V9A7 (UniProtKB/Swiss-Prot), A3F823 (UniProtKB/Swiss-Prot), A0A8I6A026 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063138063 ⟸ XM_063281993
- Peptide Label:
isoform X1
- UniProtKB:
G3V9A7 (UniProtKB/Swiss-Prot), A3F823 (UniProtKB/Swiss-Prot), A0A8I6A026 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063138067 ⟸ XM_063281997
- Peptide Label:
isoform X1
- UniProtKB:
G3V9A7 (UniProtKB/Swiss-Prot), A3F823 (UniProtKB/Swiss-Prot), A0A8I6A026 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063138064 ⟸ XM_063281994
- Peptide Label:
isoform X1
- UniProtKB:
G3V9A7 (UniProtKB/Swiss-Prot), A3F823 (UniProtKB/Swiss-Prot), A0A8I6A026 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063138065 ⟸ XM_063281995
- Peptide Label:
isoform X1
- UniProtKB:
G3V9A7 (UniProtKB/Swiss-Prot), A3F823 (UniProtKB/Swiss-Prot), A0A8I6A026 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063138068 ⟸ XM_063281998
- Peptide Label:
isoform X1
- UniProtKB:
G3V9A7 (UniProtKB/Swiss-Prot), A3F823 (UniProtKB/Swiss-Prot), A0A8I6A026 (UniProtKB/TrEMBL)
RefSeq Acc Id:
XP_063138062 ⟸ XM_063281992
- Peptide Label:
isoform X2
- UniProtKB:
A0A8I6A026 (UniProtKB/TrEMBL)
Date
Current Symbol
Current Name
Previous Symbol
Previous Name
Description
Reference
Status
2008-04-30
Mtfr1
mitochondrial fission regulator 1
Mtfr1_predicted
mitochondrial fission regulator 1 (predicted)
'predicted' is removed
2292626 APPROVED
2006-03-30
Mtfr1_predicted
mitochondrial fission regulator 1 (predicted)
RGD1304936_predicted
similar to RIKEN cDNA 1300002C08 gene (predicted)
Symbol and Name updated
1299863 APPROVED
2005-01-20
RGD1304936_predicted
similar to RIKEN cDNA 1300002C08 gene (predicted)
LOC311403_predicted
Symbol and Name status set to approved
1331353 APPROVED
2005-01-12
LOC311403_predicted
similar to RIKEN cDNA 1300002C08 gene (predicted)
Symbol and Name status set to provisional
70820 PROVISIONAL
