RH127963 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH127963

Symbol: RH127963
Previously known as: AA866323; 
RGD ID: 5039884
Expected Size: 209 (bp)
Notes this SSLP was found to have more than 4 positions (total 12 positions) on the RGSC 5.0 genome assembly for UniSTS:211273; therefore these positions have been skipped during loading
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map19p13UniSTS
Cytogenetic MapXq14UniSTS
Cytogenetic MapXq21UniSTS
Cytogenetic Map6q31UniSTS
Is Marker For: Genes:   Phb1   Phb1l1   Phb1l2   Phb1-ps13  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGGTAGGTGATGTTCCGAGAGC
Reverse Primer CAGGAAGCAGAGAGAGCCAGAT
 

Region

Nucleotide Sequences
RefSeq Transcripts NM_031851 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_002730229 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_003751829.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XM_003753080.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  XR_006662 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC072518 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC097304 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ213801 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ215559 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ229103 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ229278 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ231383 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ232197 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ233703 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ233903 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH613525.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH615635.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH617683.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH618161.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M61219 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 25344 UniSTS
  302688 UniSTS
  366709 UniSTS
  688815 UniSTS
UniSTS 211273 UniSTS