| 3252 | Pam | peptidylglycine alpha-amidating monooxygenase | ENCODES a protein that exhibits calcium ion binding; copper ion binding; identical protein binding; INVOLVED IN fatty acid primary amide biosynthetic process; heart development; lactation; PARTICIPATES IN melanocortin system pathway; ASSOCIATED WITH Brain Hypoxia; Experimental Arthritis; Hyperplasia ; FOUND IN cell surface; extracellular space; neuronal cell body; INTERACTS WITH (R)-noradrenaline; 1-naphthyl isothiocyanate; 17alpha-ethynylestradiol | 9 | 105445812 | 105719287 | Rat | 219 | symbol , PhenoGen | gene, protein-coding, PROVISIONAL [RefSeq] |
| 41198727 | Pam-ps1 | peptidylglycine alpha-amidating monooxygenase, pseudogene 1 | | 4 | 167635182 | 167639475 | Rat | | symbol , PhenoGen | gene, pseudo, MODEL [RefSeq] |
| 1312048 | Mycbp2 | MYC binding protein 2 | ENCODES a protein that exhibits guanyl-nucleotide exchange factor activity (ortholog); identical protein binding (ortholog); small GTPase binding (ortholog); INVOLVED IN branchiomotor neuron axon guidance (ortholog); cell morphogenesis involved in neuron differentiation (ortholog); central nervous s ystem projection neuron axonogenesis (ortholog); ASSOCIATED WITH autosomal dominant intellectual developmental disorder 26 (ortholog); colon cancer (ortholog); Developmental Disabilities (ortholog); FOUND IN axon (ortholog); microtubule cytoskeleton (ortholog); nucleoplasm (ortholog); INTERACTS WITH 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran | 15 | 86352061 | 86590126 | Rat | 178 | old_gene_name , old_gene_symbol | gene, protein-coding, VALIDATED [RefSeq] |
| 621329 | Rassf9 | Ras association domain family member 9 | ENCODES a protein that exhibits enzyme binding; protein domain specific binding; INVOLVED IN intracellular transport; FOUND IN cytosol; endosome; recycling endosome; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 3,3',4,4',5-pentachlorobiphenyl; ammonium chloride | 7 | 39486257 | 39518090 | Rat | 87 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 2968 | Uhmk1 | U2AF homology motif kinase 1 | ENCODES a protein that exhibits enzyme binding; protein serine/threonine kinase activity; splicing factor binding; INVOLVED IN peptidyl-serine phosphorylation; neuron projection development (ortholog); positive regulation of translational initiation (ortholog); ASSOCIATED WITH Cerebral Visual Impair ment and Intellectual Disability (ortholog); FOUND IN cytoplasm; nucleus; axon (ortholog); INTERACTS WITH 17alpha-ethynylestradiol; 2,3,7,8-tetrachlorodibenzodioxine; acetamide | 13 | 84929418 | 84949194 | Rat | 120 | old_gene_name | gene, protein-coding, PROVISIONAL [RefSeq] |
| 621865 | Kalrn | kalirin, RhoGEF kinase | ENCODES a protein that exhibits enzyme binding; guanyl-nucleotide exchange factor activity (ortholog); INVOLVED IN axonogenesis; intracellular signal transduction; nervous system development; PARTICIPATES IN ephrin - ephrin receptor bidirectional signaling axis; ASSOCIATED WITH cerebral atherosclero sis (ortholog); cerebral infarction (ortholog); coronary artery disease (ortholog); FOUND IN glutamatergic synapse; neuronal cell body; perinuclear region of cytoplasm; INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran; 2,6-dinitrotoluene | 11 | 79703345 | 80309210 | Rat | 202 | old_gene_name | gene, protein-coding, VALIDATED [RefSeq] |
| 1561897 | Uhmk1l1 | U2AF homology motif kinase 1l1 | ENCODES a protein that exhibits ATP binding (inferred); kinase activity (inferred); nucleic acid binding (inferred); FOUND IN nucleus (inferred); INTERACTS WITH 17alpha-ethynylestradiol; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine | 17 | 43147379 | 43149342 | Rat | 22 | old_gene_name | gene, protein-coding, MODEL [RefSeq] |
| 626467889 | Hspa8em1Opu | heat shock protein family A (Hsp70) member 8; endonuclease induced mutant1, Opu | The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890)(RGD:598092575) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaa atatatgg (PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 1, there is one SNP in the intron where the upstream gRNA, but this is not related to the phenotype. | | | | Rat | | description | gene, allele |
| 626467891 | Hspa8em2Opu | heat shock protein family A (Hsp70) member 8; endonuclease induced mutant 2, Opu | The Hspa8 mutation (c.284T>A) in the KK rat (NBRP Rat No. 0890) was inserted into the F344/Jcl. Knocking in of the mutant allele was performed by lsODN-mediated knock-in with the CRISPR-Cas9 system. The gRNA and PAM sequences are gtgccacaagctattaaatatatgg (PAM style='font-weight:700;'>PAM: tgg) and ccatttatggatgggctctctccc (PAM: cca). In KI rats, each PAM sequence is replaced by a silent mutation. Two lines were obtained from founder rats. In line 2, there are two SNPs in the intron where the upstream gRNA, but this is not related to the phenotype. This strain was produced with the support of the AdAMS (Advanced Animal Model Support). | | | | Rat | | description | gene, allele |
| 1598163 | Pam16 | presequence translocase associated motor 16 | INVOLVED IN negative regulation of apoptotic DNA fragmentation; negative regulation of apoptotic process; negative regulation of release of cytochrome c from mitochondria; PARTICIPATES IN presequence pathway of mitochondrial protein import; ASSOCIATED WITH Desbuquois dysplasia (ortholog); Rubinstein -Taybi syndrome (ortholog); spondylometaphyseal dysplasia Megarbane-Dagher-Melike type (ortholog); FOUND IN cytoplasm (ortholog); matrix side of mitochondrial inner membrane (ortholog); mitochondrial matrix (ortholog); INTERACTS WITH 2,3,7,8-tetrachlorodibenzodioxine; 3-chloropropane-1,2-diol; 6-propyl-2-thiouracil | 10 | 11449316 | 11457071 | Rat | 73 | symbol , PhenoGen | gene, protein-coding, VALIDATED [RefSeq] |
| 1308745 | Pamr1 | peptidase domain containing associated with muscle regeneration 1 | ENCODES a protein that exhibits calcium ion binding (inferred); serine-type endopeptidase activity (inferred); INVOLVED IN proteolysis (inferred); ASSOCIATED WITH congestive heart failure (ortholog); Experimental Liver Cirrhosis (ortholog); hepatocellular carcinoma (ortholog); FOUND IN extracellular region (inferred); INTERACTS WITH 1-naphthyl isothiocyanate; 17alpha-ethynylestradiol; 17beta-estradiol | 3 | 109340411 | 109443595 | Rat | 108 | symbol , old_gene_name , PhenoGen | gene, protein-coding, VALIDATED [RefSeq] |
| 1309676 | Prxl2a | peroxiredoxin like 2A | ENCODES a protein that exhibits antioxidant activity (ortholog); INVOLVED IN regulation of osteoclast differentiation (ortholog); FOUND IN cytoplasm (ortholog); INTERACTS WITH 1-naphthyl isothiocyanate; 2,3,7,8-tetrachlorodibenzodioxine; 2,3,7,8-Tetrachlorodibenzofuran | 16 | 16900697 | 16920521 | Rat | 145 | old_gene_name , old_gene_symbol | gene, protein-coding, PROVISIONAL [RefSeq] |
| 19165134 | C3em1Linf | complement C3; CRISPR/Cas9 system induced mutant 1, Linf | ASSOCIATED WITH increased mechanical nociceptive threshold | | | | Rat | 2 | description | gene, allele |
| 14985211 | Cyfip1em1Sage | cytoplasmic FMR1 interacting protein 1; CRISPR/Cas9 induced mutant 1, Sage | ASSOCIATED WITH abnormal brain white matter morphology; decreased myelin sheath thickness; decreased oligodendrocyte number | | | | Rat | 3 | description | gene, allele |
| 13464264 | Il2rgem1Iexas | interleukin 2 receptor subunit gamma; CRISPR/Cas9 induced mutant 1, Iexas | This mutation was established by targeting il2rg gene in F344/Jcl using CRISPR/Cas9 system. gRNA seq to Il2rg: CCAACCTCACTATGCACTATAGG (PAM: first CCA); gRNA; Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was perfo rmed by electroporation. This resulting mutation was 5-bp deletion in Il2rg gene on X chromosome. | | | | Rat | | description | gene, allele |
| 1564452 | Magmas-ps1 | mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal transduction, pseudogene 1 | INVOLVED IN ossification (ortholog); FOUND IN mitochondrial inner membrane (inferred); PAM complex, Tim23 associated import motor (inferred); TIM23 mitochondrial import inner membrane translocase complex (inferred); INTERACTS WITH flutamide; leflunomide; nefazod one | 10 | 89102411 | 89102931 | Rat | 12 | description | gene, pseudo, INFERRED [RefSeq] |
| 38599191 | Rag2em1Iexas | recombination activating 2; CRISPR/Cas9 induced mutant1, Iexas | This mutation was established by targeting Rag2 gene in F344/Jcl using CRISPR/Cas9 system. gRNA to Rag2: AACATAGCCTTAATTCAACCAGG (PAM: last AGG); Cas 9 mRNA transcribed from T7-NLS hCas9-pA (RDB13130) was used for the system. Gene transfer was performed by elect roporation. This resulting mutation was 1-bp insertion in Rag2 gene on chromosome 3. | | | | Rat | | description | gene, allele |
