Ggct Gene Search Result

Submit Data | Help | Video Tutorials | News | Publications | Download | REST API | Citing RGD | Contact

Advanced Search (OLGA)

Genes search result for Rattus norvegicus
(View Results for all Objects and Ontologies)

3 records found for search term Ggct

Refine Term:

Assembly:

Chr

Sort By:

Export

RGD ID	Symbol	Name	Description	Chr	Start	Stop	Species	Annotations	Match	Type
1304876	Ggct	gamma-glutamyl cyclotransferase	ENCODES a protein that exhibits gamma-glutamylcyclotransferase activity (ortholog); protein homodimerization activity (ortholog); INVOLVED IN release of cytochrome c from mitochondria (ortholog); PARTICIPATES IN glutathione metabolic pathway; glutathione synthase deficiency pathway; glutathionuria d ... (more) isease pathway; FOUND IN cytosol (ortholog); INTERACTS WITH (+)-schisandrin B; 17beta-estradiol; 2,3,7,8-tetrachlorodibenzodioxine	4	85453387	85459597	Rat	121	symbol , PhenoGen , old_gene_symbol	gene, protein-coding, VALIDATED [RefSeq]
408364987	C1ql3^em1Lian	complement C1q like 3; CRISPR/Cas9 induced mutant1,Lian	This C1ql3 knock out allele was induced in Wistar embryos.The exon 1 of C1ql3 was targeted with two sgRNAs of (TCATC CTC ATC CCG GTG CTGG) and (AAGGT GCT GAC AAG AGG GAGG), which, respectively, targeted on the 5′ end and the 3′ end of exon 1.Wistar embryos born from Sprague Dawley pseudo-pregnant fe ... (more) male were genotyped by polymerase chain reaction (PCR) with two upstream primers of (5′-TCCAAAAG CAG ACA AGA GGATC-3′ and 5′-CTACTTCT TCA CCT ACC ACG TCCTG-3′) and one downstream primer (5′-GGCTTCTG AAA CCT TAT ACA TTCTCG-3′). This mutant carried a 631-bp deletion resulting a premature stop at 61 bp of the open reading frame.				Rat		description	gene, allele
149735372	C3^em1Kyo	complement C3; ZFN induced mutant 1, Kyo	ZFN constructs specific for the rat C3 gene were designed to target bases 1803-1841 (NCBI reference sequence: NM_016994) of C3 (target sequence: cagggggcccgagtgggctagtggctgtggacaagggg) by Sigma-Aldrich (Tokyo, Japan). The ZF ... (more) N systems were injected into the pronucleus of SHR/Izm embryos. The pups were identified by primers flanking the target sequence (forward primer: 5'-ACTCTTCCCTGTCTTGCGTC-3'; reverse primer: 5'--AATAGAGGCCACCAATGCAC-3'). This mutant allele revealed a 9-base frameshift deletion of bases 1815-1824 (ggctagtgg).				Rat		description	gene, allele