Strain: SD-Nfe2l2em1Mcwi

Symbol: SD-Nfe2l2em1Mcwi
Strain: SD-Nfe2l2em1
Substrain: Mcwi
Ontology ID: RS:0003831
Alleles: Nfe2l2em1Mcwi
Also known as: SD-Nfe2l2em1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting TALENs targeting the sequence TAGTCCTGGCGGTGGCAATTCCAAGTCCATCATGCTGAGGGCGGACGCTGCGCTA into Crl:SD Sprague Dawley rat embryos. The resulting mutation is a 41-bp deletion in exon 1.
Last Known Status: Live Animals (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0362,497,568 - 62,525,146RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0369,041,641 - 69,069,190RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4358,366,693 - 58,394,116RGD_MAPPER_PIPELINERGSC3.4

Mutant Strains




Experimental Data Annotations
References - curated

Region


Additional Information

Nomenclature History
 
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 9588552
Created: 2014-10-30
Species: Rattus norvegicus
Last Modified: 2017-01-26
Status: ACTIVE