Strain Report - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Strain Registration

Strain: SS-Nos3em13Mcwi

Symbol: SS-Nos3em13Mcwi
Strain: SS-Nos3em13
Substrain: Mcwi
RGD ID: 6893431
Citation ID: RRID:RGD_6893431
Ontology ID: RS:0003323
Alleles: Nos3em13Mcwi
Also Known As: SS-Nos3em13Mcwi; SS-Nos3em13Mcwi; SS-Nos3^[em13Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence GACTTCATCAATCAGTACtataaCTCGATCAAAAGGTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 165-bp deletion including part of exon 3, intron 3, and part of exon 4
Last Known Status: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2410,811,102 - 10,811,266RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.047,321,908 - 7,342,404RGD_MAPPER_PIPELINERnor6.0
Rnor_5.047,333,272 - 7,353,767RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.446,158,847 - 6,179,441RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. MicroRNA-214-3p in the Kidney Contributes to the Development of Hypertension. Liu Y, etal., J Am Soc Nephrol. 2018 Oct;29(10):2518-2528. doi: 10.1681/ASN.2018020117. Epub 2018 Jul 26.
3. PhysGen Knockouts PhysGen Knockout strains
4. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Nos3em13Mcwi-var1 chr4 10811102 10811266 CTGCTCATGAGCCTGGGAA CCACTCCTGGGGAGAGGAGAGGGCCACAAGCCTTGGCGTCAGGATGGTGAAAGGGCTGGGGAATGAGGTGATCTGAAGGC TCCTCCACTCAGGGTGAGGGTGTTGGGAGGAGCAGGGGAGACCCACCTTTTGATCGAGTTATAGTA - deletion mRatBN7.2

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-04-03 SS-Nos3em13Mcwi    SS-Nos3em13Mcwi    Symbol updated 68687 APPROVED
2014-04-03 SS-Nos3em13Mcwi    SS-Nos3em13Mcwi    Symbol updated 68687 APPROVED
2014-04-03 SS-Nos3em13Mcwi    SS-Nos3em13Mcwi    Name updated 68913 APPROVED
2014-04-03 SS-Nos3em13Mcwi    SS-Nos3em13Mcwi    Name updated 68913 APPROVED
2013-08-15 SS-Nos3em13Mcwi    SS-Nos3em13Mcwi    Name updated 68913 APPROVED
2013-08-15 SS-Nos3em13Mcwi    SS-Nos3em13Mcwi    Name updated 68913 APPROVED