Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Adora2bem2Mcwi

Symbol: SS-Adora2bem2Mcwi
Strain: SS-Adora2bem2
Substrain: Mcwi
RGD ID: 6484715
Citation ID: RRID:RGD_6484715
Ontology ID: RS:0003284
Alleles: Adora2bem2Mcwi
Also Known As: SS-Adora2bem2Mcwi; SS-Adora2b^[em2Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence AACTACTTTCTGGTGTccctgGCGACGGCGGACGTGGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 162-bp deletion in exon 1
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Genotyping Protocol Download Genotyping Protocol
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21046,940,394 - 46,956,772RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.01048,569,563 - 48,586,366RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01048,358,163 - 48,358,324RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41048,421,592 - 48,437,967RGD_MAPPER_PIPELINERGSC3.4





References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. Characterization of Dahl salt-sensitive rats with genetic disruption of the A2B adenosine receptor gene: implications for A2B adenosine receptor signaling during hypertension. Nayak S, etal., Purinergic Signal. 2015 Dec;11(4):519-31. doi: 10.1007/s11302-015-9470-7. Epub 2015 Sep 18.
3. PhysGen Knockouts PhysGen Knockout strains
4. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Adora2bem2Mcwi-var1 chr10 48358163 48358324 GCTGGCCCGGCCATGCAGCTAGAGACGCAGGACGCGCTGTACGTGGCGCTGGAGCTGGTTATCGCCGCGCTGGCAGTGGCGGGCAACGTGCTGGTGTGCGCTGCGGTGGGAGCCTCGAGTGCTTTACAGACCCCCACCAACTACTTTCTGGTGTCCCTGGCG - deletion Rnor_5.0

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-04-03 SS-Adora2bem2Mcwi    SS-Adora2bem2Mcwi    Symbol updated 68687 APPROVED
2014-04-03 SS-Adora2bem2Mcwi    SS-Adora2bem2Mcwi    Symbol updated 68687 APPROVED
2014-04-03 SS-Adora2bem2Mcwi    SS-Adora2bem2Mcwi    Name updated 68913 APPROVED
2014-04-03 SS-Adora2bem2Mcwi    SS-Adora2bem2Mcwi    Name updated 68913 APPROVED
2013-08-15 SS-Adora2bem2Mcwi    SS-Adora2bem2Mcwi    Name updated 68913 APPROVED
2013-08-15 SS-Adora2bem2Mcwi    SS-Adora2bem2Mcwi    Name updated 68913 APPROVED