|
# | Reference Title | Reference Citation |
1. | Knockout rats via embryo microinjection of zinc-finger nucleases. | Geurts AM, etal., Science. 2009 Jul 24;325(5939):433. |
2. | Characterization of Dahl salt-sensitive rats with genetic disruption of the A2B adenosine receptor gene: implications for A2B adenosine receptor signaling during hypertension. | Nayak S, etal., Purinergic Signal. 2015 Dec;11(4):519-31. doi: 10.1007/s11302-015-9470-7. Epub 2015 Sep 18. |
3. | PhysGen Knockouts | PhysGen Knockout strains |
4. | RGD Strain RSO annotation pipeline | RGD Automated Pipelines |
Name | Chromosome | Start Pos | End Pos | Reference Nucleotide | Variant Nucleotide | Variant Type | Assembly |
Adora2bem2Mcwi-var1 | chr10 | 48358163 | 48358324 | GCTGGCCCGGCCATGCAGCTAGAGACGCAGGACGCGCTGTACGTGGCGCTGGAGCTGGTTATCGCCGCGCTGGCAGTGGCGGGCAACGTGCTGGTGTGCGCTGCGGTGGGAGCCTCGAGTGCTTTACAGACCCCCACCAACTACTTTCTGGTGTCCCTGGCG | - | deletion | Rnor_5.0 |
Date | Current Symbol | Current Name | Previous Symbol | Previous Name | Description | Reference | Status |
---|---|---|---|---|---|---|---|
2014-04-03 | SS-Adora2bem2Mcwi | SS-Adora2bem2Mcwi | Symbol updated | 68687 | APPROVED | ||
2014-04-03 | SS-Adora2bem2Mcwi | SS-Adora2bem2Mcwi | Symbol updated | 68687 | APPROVED | ||
2014-04-03 | SS-Adora2bem2Mcwi | SS-Adora2bem2Mcwi | Name updated | 68913 | APPROVED | ||
2014-04-03 | SS-Adora2bem2Mcwi | SS-Adora2bem2Mcwi | Name updated | 68913 | APPROVED | ||
2013-08-15 | SS-Adora2bem2Mcwi | SS-Adora2bem2Mcwi | Name updated | 68913 | APPROVED | ||
2013-08-15 | SS-Adora2bem2Mcwi | SS-Adora2bem2Mcwi | Name updated | 68913 | APPROVED |