Strain: SS-Sh2b3em2Mcwi

Symbol: SS-Sh2b3em2Mcwi
Strain: SS-Sh2b3em2
Substrain: Mcwi
Ontology ID: RS:0003012
Alleles: Sh2b3em2Mcwi
Also known as: SS-Sh2b3em2Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNS targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 2.
Availability: Live Animals; Sperm

Mutant Strains




References - curated

Region


Additional Information

Nomenclature History
  
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 5509994
Created: 2011-11-16
Species: Rattus norvegicus
Last Modified: 2011-11-17
Status: ACTIVE



Contact Us |  About Us |  Jobs at RGD