Strain Report - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Strain: SS-Pruneem1Mcwi

Symbol: SS-Pruneem1Mcwi
Strain: SS-Pruneem1
Substrain: Mcwi
RGD ID: 5508364
Citation ID: RRID:RGD_5508364
Ontology ID: RS:0002927
Alleles: Pruneem1Mcwi
Also Known As: SS-Pruneem1Mcwi; SS-Prune^[em1Mcwi]
Type: mutant
Available Source: Not Available
Origination: PhysGen Knockouts
Description: This strain was produced by injecting ZFNs targeting the sequence ACCTCCGGCTTCACCATGgaggacTACTTGCAGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 198-bp deletion in the 5 prime URT and exon 1.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.22182,858,954 - 182,859,151RGD_MAPPER_PIPELINEmRatBN7.2
Rnor_6.02196,427,714 - 196,457,105RGD_MAPPER_PIPELINERnor6.0
Rnor_5.02215,924,545 - 215,954,221RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.42190,165,356 - 190,192,807RGD_MAPPER_PIPELINERGSC3.4






References

References - curated
# Reference Title Reference Citation
1. Knockout rats via embryo microinjection of zinc-finger nucleases. Geurts AM, etal., Science. 2009 Jul 24;325(5939):433.
2. PhysGen Knockouts PhysGen Knockout strains
3. RGD Strain RSO annotation pipeline RGD Automated Pipelines

Region

Allelic Variants
Name Chromosome Start Pos End Pos Reference Nucleotide Variant Nucleotide Variant Type Assembly
Pruneem1Mcwi-var1 chr2 182858954 182859151 CTCCAGGCTCTCCCGCCCATGGGCGAAGGGTTTGGTCCTCCAGCTCTCCCGCGTTCACCTCTGTGATCCCTCCACACCGACTGTCCGGGCTCCCCAGATCCCACACCTTCGTCCTTCCCCGACCCCACGCTGCATTCCTTTCGGTCACGGACTGAGACCCGTTACCTGCAAAGCGGCTCGACAGTCCTGCAAGTAGTC - deletion mRatBN7.2

Additional Information


Nomenclature History
Date Current Symbol Current Name Previous Symbol Previous Name Description Reference Status
2014-03-26 SS-Pruneem1Mcwi    SS-Pruneem1Mcwi    Symbol updated 68687 APPROVED
2014-03-26 SS-Pruneem1Mcwi    SS-Pruneem1Mcwi    Name updated 68913 APPROVED
2014-03-26 SS-Pruneem1Mcwi    SS-Pruneem1Mcwi    Symbol updated 68687 APPROVED
2014-03-26 SS-Pruneem1Mcwi    SS-Pruneem1Mcwi    Name updated 68913 APPROVED
2013-08-14 SS-Pruneem1Mcwi    SS-Pruneem1Mcwi    Name updated 68913 APPROVED
2013-08-14 SS-Pruneem1Mcwi    SS-Pruneem1Mcwi    Name updated 68913 APPROVED
2012-01-12 SS-Pruneem1Mcwi    SS-Pruneem1Mcwi    Name updated 68913 APPROVED
2012-01-12 SS-Pruneem1Mcwi    SS-Pruneem1Mcwi    Name updated 68913 APPROVED