Strain: ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi-Asipem1Mcwi

Symbol: ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi-Asipem1Mcwi
Strain: ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90)/EurMcwi-Asipem1
Substrain: Mcwi
Ontology ID: RS:0002636
Alleles: Asipem1Mcwi
Also known as: ACI.FHH-(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90EurMcwi-Asipem1Mcwi;Rf-1A+4-Asipem1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence agccacctggtatttgaggagacgcttggagatgac into ACI.FHH(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90) embryos. The result is a 5-bp frameshift deletion in exon 2.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.03150,492,010 - 150,579,870RGD_MAPPER_PIPELINERnor6.0
Rnor_5.03156,860,395 - 156,949,277RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.43145,445,175 - 145,536,831RGD_MAPPER_PIPELINERGSC3.4





Experimental Data Annotations
References - curated

Region


Additional Information

 
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 5144102
Created: 2011-07-29
Species: Rattus norvegicus
Last Modified: 2017-01-26
Status: ACTIVE