Strain: SS-Sh2b3em1Mcwi

Symbol: SS-Sh2b3em1Mcwi
Strain: SS-Sh2b3em1
Substrain: Mcwi
Ontology ID: RS:0002439
Alleles: Sh2b3em1Mcwi
Also known as: SS-Sh2b3em1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2.

Mutant Strains




References - curated

Region


Additional Information

  
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 4139885
Created: 2010-08-20
Species: Rattus norvegicus
Last Modified: 2010-08-20
Status: ACTIVE



Contact Us |  About Us |  Jobs at RGD