Strain: SS-Nox4em2Mcwi

Symbol: SS-Nox4em2Mcwi
Strain: SS-Nox4em2
Substrain: Mcwi
Ontology ID: RS:0002437
Alleles: Nox4em2Mcwi
Also known as: SS-Nox4em2Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence ggttacagcttctacctatgcaataaggtaagggtc into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 7.
Last Known Status: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01150,796,359 - 150,976,186RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01157,106,652 - 157,285,107RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41143,415,816 - 143,603,554RGD_MAPPER_PIPELINERGSC3.4

Mutant Strains




Experimental Data Annotations
References - curated

Region


Additional Information

Nomenclature History
 
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 4139883
Created: 2010-08-20
Species: Rattus norvegicus
Last Modified: 2017-01-26
Status: ACTIVE