Strain: SS-Mmp2em2Mcwi

Symbol: SS-Mmp2em2Mcwi
Strain: SS-Mmp2em2
Substrain: Mcwi
Ontology ID: RS:0002432
Alleles: Mmp2em2Mcwi
Also known as: SS-Mmp2em2Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 7.
Last Known Status: Unknown (as of 2017-07-18)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01915,542,771 - 15,570,589RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01926,629,728 - 26,658,966RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41915,246,036 - 15,275,061RGD_MAPPER_PIPELINERGSC3.4

Mutant Strains




Experimental Data Annotations
References - curated

Region


Additional Information

Nomenclature History
 
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 4139878
Created: 2010-08-20
Species: Rattus norvegicus
Last Modified: 2010-08-20
Status: ACTIVE