Strain: SS-Rag1em2Mcwi

Symbol: SS-Rag1em2Mcwi
Strain: SS-Rag1em2
Substrain: Mcwi
Ontology ID: RS:0002427
Alleles: Rag1em2Mcwi
Also known as: SS-Rag1em2Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon1.
Last Known Status: Live Animals; Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0391,206,394 - 91,217,491RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0397,866,048 - 97,877,145RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4386,780,782 - 86,791,878RGD_MAPPER_PIPELINERGSC3.4

Mutant Strains




Phenotype Annotations
Experimental Data Annotations
Phenotype Values via Phenominer
References - curated
RGD Disease Portals

Region


Additional Information

RGD Curation Notes
Nomenclature History
 
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 4139873
Created: 2010-08-20
Species: Rattus norvegicus
Last Modified: 2017-01-26
Status: ACTIVE