Strain: SS-Adamts16em1Bj

Symbol: SS-Adamts16em1Bj
Strain: SS-Adamts16em1
Substrain: Bj
Ontology ID: RS:0004559
Alleles: Adamts16em1Bj
Also known as: Adamts16 mutant
Type: mutant
Source: University of Toledo College of Medicine and Life Sciences, Toledo, OH 43614.
Origin: This strain was produced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1.
Last Known Status: Unknown
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0135,067,268 - 35,200,530RGD_MAPPER_PIPELINERnor6.0
Rnor_5.0136,468,949 - 36,599,799RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.4172,559,771 - 2,690,663RGD_MAPPER_PIPELINERGSC3.4





Disease Annotations
Phenotype Annotations
Experimental Data Annotations
References - curated
RGD Disease Portals

Region


Additional Information

 
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 13437612
Created: 2017-10-10
Species: Rattus norvegicus
Last Modified: 2017-10-10
Status: ACTIVE