D4Kini9 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D4Kini9

Symbol: D4Kini9
Previously known as:
RGD ID: 7241161
Expected Size: 209 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2432,022,715 - 32,022,924 (+)MAPPERmRatBN7.2
Rnor_6.0428,988,883 - 28,989,091NCBIRnor6.0
Rnor_6.0431,387,133 - 31,387,341NCBIRnor6.0
Cytogenetic Map4 RGD


Annotation


References - curated
# Reference Title Reference Citation
1. The calcitonin receptor gene is a candidate for regulation of susceptibility to herpes simplex type 1 neuronal infection leading to encephalitis in rat. Abdelmagid N, etal., PLoS Pathog. 2012;8(6):e1002753. doi: 10.1371/journal.ppat.1002753. Epub 2012 Jun 28.
2. Data registered by Dr. Olsson Personal communication between Dr. Olsson and the RGD curators.
3. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AATATCCACTTTCCCACTAC
Reverse Primer GCTGGAGACAAAAGTTTTAC
 

Region

Nucleotide Sequences
GenBank Nucleotide AC094253.7 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH614513.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2313401Anxrr27Anxiety related response QTL 27aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)41793350862933508Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)411320076180699135Rat
631642Stl2Serum triglyceride level QTL 23.3blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521917856647776Rat
6478724Anxrr35Anxiety related response QTL 350.00449defecation behavior trait (VT:0010462)defecation measurement (CMO:0000997)41008408955084089Rat
6478766Anxrr47Anxiety related response QTL 470.09637locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)41008408955084089Rat
6478769Anxrr48Anxiety related response QTL 480.02514locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)41008408955084089Rat
738021Hcar13Hepatocarcinoma resistance QTL 134.3liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)4132584199Rat
8694374Bw155Body weight QTL 1553.390.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)41008408955084089Rat
9590304Scort17Serum corticosterone level QTL 174.960.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)41008408955084089Rat
8552906Pigfal3Plasma insulin-like growth factor 1 level QTL 3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)41008408955084089Rat
634323Hc2Hypercalciuria QTL 22.15urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)421079645210796Rat
6909122Insul22Insulin level QTL 224.63blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)42690728575585128Rat
8655906Rf60Renal function QTL 603.8blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)42949419581006281Rat
8552803Bw144Body weight QTL 14416body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)42271068534430484Rat
1300141Bp178Blood pressure QTL 178arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)41002490139524530Rat
1357341Gluco5Glucose level QTL 56.4adipocyte free fatty acid secretion trait (VT:0010465)absolute change in adipocyte free fatty acid secretion per unit volume (CMO:0001446)4133250345Rat
1357343Gluco4Glucose level QTL 40.00002adipocyte glucose uptake trait (VT:0004185)adipocyte maximal glucose uptake to basal glucose uptake ratio (CMO:0000874)4133250345Rat
1354665Stl10Serum triglyceride level QTL 103.57blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)42133334344463908Rat
1358203Stl19Serum triglyceride level QTL 192.80.002blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829465958103Rat
61412Pia2Pristane induced arthritis QTL 23.9joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)42133334362278020Rat
61415Eae11Experimental allergic encephalomyelitis QTL 112.9nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)4139505420Rat
70222Eae2Experimental allergic encephalomyelitis QTL 24.3nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)42133334339505420Rat
619616Bp79Blood pressure QTL 790.0292arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4521460278882945Rat
631209Bw2Body weight QTL24.2retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)4994088544463908Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)41081417091360527Rat
2302371Stl22Serum triglyceride level QTL 225.15blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829457114705Rat
2303585Bw86Body weight QTL 864body mass (VT:0001259)body weight (CMO:0000012)41467806559678065Rat
6909128Pancm4Pancreatic morphology QTL 411.35pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)42690728575585128Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45214602146446691Rat


Additional Information

Database Acc Id Source(s)
UniSTS 547941 UniSTS