RH47096 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH47096

Symbol: RH47096
Previously known as:
RGD ID: 7205792
Expected Size: 111 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2611,421,732 - 11,421,843 (-)MAPPERmRatBN7.2
mRatBN7.210101,257,662 - 101,257,861 (+)MAPPERmRatBN7.2
Rnor_6.066,470,591 - 6,470,701NCBIRnor6.0
Rnor_6.010104,574,841 - 104,575,039NCBIRnor6.0
Rnor_5.010103,710,333 - 103,710,531UniSTSRnor5.0
Rnor_5.066,427,551 - 6,427,661UniSTSRnor5.0
Celera1099,831,794 - 99,831,992UniSTS
Celera611,126,001 - 11,126,111UniSTS
Cytogenetic Map10q32.3UniSTS
Is Marker For: Genes:   H3f3b   H3f3a-ps3  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGATTTCAAAACCGACCTGA
Reverse Primer TGGATGGCACACAGGTTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1584001H3f3a-ps3H3.3 histone A, pseudogene 361142150211422456Rat
621095H3f3bH3.3 histone B10101256484101258716Rat

Nucleotide Sequences
RefSeq Transcripts NM_053985.2 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AC130970.4 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC063159.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  BC078759.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ215473.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ225133.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ225528.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ226787.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ227040.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ227260.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ227957.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ228569.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ232451.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ232671.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ232852.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ234172.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ234408.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  FQ235236.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  X73683.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
738023Alc17Alcohol consumption QTL 173.10.003consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)6127574569Rat
1354616Despr12Despair related QTL 120.0012locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)6127574569Rat
1549905Stresp10Stress response QTL 106.830.0066stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)6127574569Rat
2300176Bmd51Bone mineral density QTL 5111.70.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)6127574569Rat
2300190Bmd52Bone mineral density QTL 5211.20.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)6127574569Rat
1331743Uae28Urinary albumin excretion QTL 284.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)6134235784Rat
1578758Tcas9Tongue tumor susceptibility QTL 93.29tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)6137618905Rat
1598843Cm63Cardiac mass QTL 632.6heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)6139036266Rat
7411603Foco13Food consumption QTL 135.50.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)6141223769Rat
8552962Pigfal16Plasma insulin-like growth factor 1 level QTL 169.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)6141223769Rat
7411542Bw127Body weight QTL 1275.50.001body mass (VT:0001259)body weight gain (CMO:0000420)6141223769Rat
9589129Insul24Insulin level QTL 2419.060.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)6141223769Rat
9589048Scfw3Subcutaneous fat weight QTL 34.570.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)6141223769Rat
2293709Bss23Bone structure and strength QTL 235.180.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)6142487980Rat
2293650Bss31Bone structure and strength QTL 315.050.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)6142487980Rat
2293656Bss28Bone structure and strength QTL 286.790.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)6142487980Rat
7411584Foco4Food consumption QTL 44.30.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)6142838846Rat
738024Sach5Saccharine consumption QTL 53.90.00039consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)6143394190Rat
2301972Bp325Blood pressure QTL 3254.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)6172227641Rat
2293706Bmd20Bone mineral density QTL 204.30.0002femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)6507449719988050Rat
1300128Rf16Renal function QTL 163.89renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6507449734434305Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6507449754641141Rat
1358190Ept1Estrogen-induced pituitary tumorigenesis QTL 14.4pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)6984331220338915Rat
2292616Ept15Estrogen-induced pituitary tumorigenesis QTL 154.4pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)6984331220338915Rat
4145119Mcs25Mammary carcinoma susceptibility QTL 250.0001mammary gland integrity trait (VT:0010552)ratio of deaths to total study population during a period of time (CMO:0001023)610894415110548006Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109658275104670812Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014487011104060283Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014487011107057807Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1029299504107211142Rat
1576308Schws1Schwannoma susceptibility QTL 10.0041nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)1040035094102359817Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1042045676104670812Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1051770177107211142Rat
61387Bp1Blood pressure QTL 15.1arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)1051770177107211142Rat
70171Cari1Carrageenan-induced inflammation QTL 14.90.0005hypodermis integrity trait (VT:0010550)inflammatory exudate volume (CMO:0001429)1053797385107211142Rat
2312662Slep8Serum leptin concentration QTL 80.05blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)1057134272102134272Rat
2312668Scl65Serum cholesterol level QTL 650.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1057134272102134272Rat
2312672Insul15Insulin level QTL 150.01blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1057134272102134272Rat
1549831Bss6Bone structure and strength QTL 64lumbar vertebra strength trait (VT:0010574)vertebra ultimate force (CMO:0001678)1057576521102576521Rat
2293698Bss43Bone structure and strength QTL 435.330.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra cross-sectional area (CMO:0001689)1059209888104209888Rat
2313103Bss80Bone structure and strength QTL 8020.0001tibia strength trait (VT:1000284)tibia midshaft endosteal cross-sectional area (CMO:0001716)1062057807107057807Rat
2313105Bss79Bone structure and strength QTL 791.80.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)1062057807107057807Rat
61449Ciaa2CIA Autoantibody QTL 27.1blood autoantibody amount (VT:0003725)calculated serum anti-type 2 collagen antibody titer (CMO:0001279)1063221094107211142Rat
2317029Aia19Adjuvant induced arthritis QTL 192.98joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1066978955107211142Rat
2317039Aia6Adjuvant induced arthritis QTL 64.31joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)1066978955107211142Rat
10450498Bp384Blood pressure QTL 3840.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1067750049107211142Rat
1642980Bp300Blood pressure QTL 300arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1068383129107211142Rat
61396Bp9Blood pressure QTL 94.80.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1068420376107211142Rat
2300172Bmd57Bone mineral density QTL 579.80.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)1069738412107211142Rat
2293646Bss25Bone structure and strength QTL 2510.960.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1069738412107211142Rat
2293663Bss33Bone structure and strength QTL 339.340.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1069738412107211142Rat
6893366Bw106Body weight QTL 1060.30.47body mass (VT:0001259)body weight (CMO:0000012)1070199100107211142Rat
70193Mcs7Mammary carcinoma susceptibility QTL 72.38mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1072224939107211142Rat
2298548Neuinf7Neuroinflammation QTL 73.4nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)1072224939107211142Rat
2292438Bp311Blood pressure QTL 311arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1076246085107211142Rat
1302404Cia27Collagen induced arthritis QTL 272.60.0045joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)1076452683107211142Rat
4889492Pancm2Pancreatic morphology QTL 23.2pancreatic beta cell morphology trait (VT:0005217)ratio of insulin-positive cell area to total area of splenic region of pancreas (CMO:0001814)1076748906107211142Rat
6893357Bw102Body weight QTL 1020.50.36body mass (VT:0001259)body weight (CMO:0000012)1080515287101325465Rat
2303589Bw87Body weight QTL 872body mass (VT:0001259)body weight (CMO:0000012)1081285008107211142Rat
2317754Glom25Glomerulus QTL 253.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)1082685200107211142Rat
1600367Mcs15Mammary carcinoma susceptibility QTL 154.5mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1085565469103884409Rat
631538Oia5Oil induced arthritis QTL 5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1087055121107211142Rat
61363Oia3Oil induced arthritis QTL 30.001joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1087307617107211142Rat
634320Niddm49Non-insulin dependent diabetes mellitus QTL 494.41blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1088539139107211142Rat
12880395Cm109Cardiac mass QTL 1090.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)1090404397107211142Rat
12880396Am13Aortic mass QTL 130.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)1090404397107211142Rat
12880398Kidm67Kidney mass QTL 670.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1090404397107211142Rat
12880384Cm107Cardiac mass QTL 1070.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)90404397107211142Rat
12880385Cm108Cardiac mass QTL 1080.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)90404397107211142Rat
1579915Bp280Blood pressure QTL 2800.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1090404397107211142Rat
1300137Bp186Blood pressure QTL 1863.57arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)1090627439107057807Rat
724530Bp149Blood pressure QTL 1490.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1090627439107211142Rat
61436Cia5Collagen induced arthritis QTL 54.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1091228102104060283Rat
1354641Bvd2Brain ventricular dilatation QTL 26.360.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)1093223816107057807Rat
10450493Bp382Blood pressure QTL 3820.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1094759759107211142Rat
2292436Bp310Blood pressure QTL 310arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1094759759107211142Rat
1576307Cia28Collagen induced arthritis QTL 28joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1096120911104060283Rat
1576313Pia25Pristane induced arthritis QTL 25joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1096120911104060283Rat
1578663Bss18Bone structure and strength QTL 183.6femur width (VT:1000666)femoral neck width (CMO:0001695)1096703043107057807Rat
1578672Bmd16Bone mineral density QTL 166.2femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)1096703043107057807Rat
631539Oia6Oil induced arthritis QTL 6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1097010147104670812Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 117056 UniSTS
  690171 UniSTS
UniSTS 52431 UniSTS