D10Mco25 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D10Mco25

Symbol: D10Mco25
Previously known as: oxsts4605; 
RGD ID: 66374
Expected Size: 280 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21024,367,708 - 24,367,986 (+)MAPPERmRatBN7.2
Rnor_6.01025,100,943 - 25,101,220NCBIRnor6.0
Rnor_5.01024,953,879 - 24,954,156UniSTSRnor5.0
RGSC_v3.41024,955,610 - 24,955,888RGDRGSC3.4
RGSC_v3.41024,955,611 - 24,955,888UniSTSRGSC3.4
RGSC_v3.11024,956,659 - 24,956,937RGD
Celera1023,944,548 - 23,944,825UniSTS
Cytogenetic Map10 RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Medical College of Ohio's SSLP Data file transfer Rapp J, Dene H,Direct Electronic Data transfer Feb.(5)2001 . Medical College of Ohio Department of Physiology and Molecular Medicine.
3. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTACAACTCAAACACAAG
Reverse Primer TATATCAGAGTAATGCTAAC
 

Region

Nucleotide Sequences
GenBank Nucleotide U53404 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2293680Bss40Bone structure and strength QTL 405.660.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)10135225947Rat
634327Hc4Hypercalciuria QTL 42.4urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)10138328221Rat
7411611Foco17Food consumption QTL 1718.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)10142315980Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)10180676123Rat
10401803Kidm50Kidney mass QTL 50kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1041834445418344Rat
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1074336463851208Rat
2313064Bmd71Bone mineral density QTL 710.90.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)10538701450387014Rat
2313066Bss63Bone structure and strength QTL 631.40.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)10538701450387014Rat
2313081Bss64Bone structure and strength QTL 641.30.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)10538701450387014Rat
2313095Bss62Bone structure and strength QTL 621.50.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)10538701450387014Rat
2313104Bss61Bone structure and strength QTL 610.90.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)10538701450387014Rat
2298544Neuinf9Neuroinflammation QTL 94.6nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)10580199062146030Rat
8662860Vetf10Vascular elastic tissue fragility QTL 10artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)10615418273453136Rat
61427Cia16Collagen induced arthritis QTL 163.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10635789696121100Rat
1578761Stresp21Stress response QTL 213.3thymus mass (VT:0004954)thymus wet weight (CMO:0000855)10637574651375746Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109658275104670812Rat
9590310Scort19Serum corticosterone level QTL 196.30.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101147401056474010Rat
9590268Scort13Serum corticosterone level QTL 133.260.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101147401056474010Rat
9589136Insul27Insulin level QTL 2710.460.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)101147401056474010Rat
2301967Cm73Cardiac mass QTL 734.55heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)101448701189062041Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014487011104060283Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014487011107057807Rat
1354587Kidm21Kidney mass QTL 213.3kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)101502851360430477Rat
631564Apr3Acute phase response QTL 33.9blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)101527595560275955Rat
6893350Bw99Body weight QTL 990.870.16body mass (VT:0001259)body weight (CMO:0000012)11590666560906665Rat
6893352Bw100Body weight QTL 1000.330.6body mass (VT:0001259)body weight (CMO:0000012)11590666560906665Rat
631532Cm50Cardiac mass QTL 506.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)101790711351786432Rat
1598852Anxrr19Anxiety related response QTL 195.07body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)101816784163167841Rat
2313055Bw96Body weight QTL 963.60.0001body mass (VT:0001259)body weight (CMO:0000012)101960648364606483Rat
2313087Bmd80Bone mineral density QTL 803.20.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)101960648364606483Rat
1554317Bmd4Bone mineral density QTL 49.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)101981604299406971Rat
1581497Esta1Estrogen-induced thymic atrophy QTL 1thymus mass (VT:0004954)thymus wet weight (CMO:0000855)102132980561345413Rat
724556Pur2Proteinuria QTL 25.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)102242750090627625Rat
631531Iresp2Immunoglobin response QTL26.3blood immunoglobulin E amount (VT:0002492)serum immunoglobulin E level (CMO:0002101)102291826836400810Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Nucleotide U53404
UniSTS 240202 UniSTS