D15Uia1 Marker Search Result - Rat Genome Database

Symbol:

D15Uia1

Previously known as:

oxsts8515;

RGD ID:

62440

Expected Size:

177 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	15	1,197,516 - 1,197,686 (+)	MAPPER	mRatBN7.2
Rnor_6.0	15	1,241,476 - 1,241,645	NCBI	Rnor6.0
Rnor_5.0	15	1,226,487 - 1,226,656	UniSTS	Rnor5.0
RGSC_v3.4	15	1,163,758 - 1,163,928	RGD	RGSC3.4
RGSC_v3.4	15	1,163,759 - 1,163,928	UniSTS	RGSC3.4
RGSC_v3.1	15	1,163,758 - 1,163,928	RGD
Celera	15	3,365,700 - 3,365,869	UniSTS
Cytogenetic Map	15		RGD

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	Medical College of Ohio's SSLP Data file transfer	Rapp J, Dene H,Direct Electronic Data transfer Feb.(5)2001 . Medical College of Ohio Department of Physiology and Molecular Medicine.
3.	UniSTS Pipeline	RGD automated pipelines
4.	Electronic SSLP Data Transfer	Sheffield V, Direct Electronic Transfer of SSLP Dataset.2000 Oct;10.

Strains and Sequence

Sequence


Forward Primer	GAACTCACACATTAAGGCAAG
Reverse Primer	GTGGCTAGTACCTATCTATCTATGG

Region

Nucleotide Sequences


GenBank Nucleotide	AF054061	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1354657	Despr13	Despair related QTL 13		0.0022	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	15	1	29912054	Rat
8552920	Pigfal8	Plasma insulin-like growth factor 1 level QTL 8	3		blood insulin-like growth factor amount (VT:0010479)	plasma insulin-like growth factor 1 level (CMO:0001299)	15	1	34723002	Rat
8694361	Abfw6	Abdominal fat weight QTL 6	10.2	0.001	visceral adipose mass (VT:0010063)	abdominal fat pad weight to body weight ratio (CMO:0000095)	15	1	34723002	Rat
9589149	Insul29	Insulin level QTL 29	9.06	0.001	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	15	1	34723002	Rat
731170	Pur3	Proteinuria QTL 3	2.3	0.0005	urine protein amount (VT:0005160)	urine protein excretion rate (CMO:0000759)	15	1	41686771	Rat
1641887	Alcrsp14	Alcohol response QTL 14			response to alcohol trait (VT:0010489)	brain neurotensin receptor 1 density (CMO:0002068)	15	1	42356671	Rat
2298549	Neuinf12	Neuroinflammation QTL 12	3.5		nervous system integrity trait (VT:0010566)	spinal cord beta-2 microglobulin mRNA level (CMO:0002125)	15	1	55302115	Rat
10401805	Kidm51	Kidney mass QTL 51			kidney mass (VT:0002707)	both kidneys wet weight (CMO:0000085)	15	306329	45306329	Rat
5684946	Bss98	Bone structure and strength QTL 98	3.9	0.0026	tibia strength trait (VT:1000284)	tibia ultimate force (CMO:0001734)	15	1058250	14481294	Rat

Additional Information

RGD Curation Notes

Note Type	Note	Reference

External Database Links

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Send us a Message