D1Uia13 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: D1Uia13

Symbol: D1Uia13
Previously known as: oxsts4621; 
RGD ID: 62435
Expected Size: 274 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.216,740,221 - 6,740,495 (+)MAPPERmRatBN7.2
Rnor_6.016,471,175 - 6,471,448NCBIRnor6.0
Rnor_5.018,116,379 - 8,116,652UniSTSRnor5.0
RGSC_v3.417,117,475 - 7,117,749RGDRGSC3.4
RGSC_v3.417,117,476 - 7,117,749UniSTSRGSC3.4
RGSC_v3.117,117,475 - 7,117,749RGD
Celera15,246,236 - 5,246,509UniSTS
Cytogenetic Map1p13UniSTS
Is Marker For: Genes:   Utrn  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. Medical College of Ohio's SSLP Data file transfer Rapp J, Dene H,Direct Electronic Data transfer Feb.(5)2001 . Medical College of Ohio Department of Physiology and Molecular Medicine.
3. UniSTS Pipeline RGD automated pipelines
4. Electronic SSLP Data Transfer Sheffield V, Direct Electronic Transfer of SSLP Dataset.2000 Oct;10.

Strains and Sequence

Sequence
 
Forward Primer CTCCAGGCTGTCTGTCTATCA
Reverse Primer ACATACCAGTAGTTGGAGGTGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3947Utrnutrophin167208547224313Rat

Nucleotide Sequences
GenBank Nucleotide AF054139 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354647Despr8Despair related QTL 80.0000341locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1124744506Rat
2298546Neuinf4Neuroinflammation QTL 45.1nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)1128736750Rat
2313053Bss51Bone structure and strength QTL 513.80.0001tibia length (VT:0004357)tibia length (CMO:0000450)1132356093Rat
2313070Bss52Bone structure and strength QTL 524.40.0001body length (VT:0001256)body length (CMO:0000013)1132356093Rat
2313090Bmd69Bone mineral density QTL 694.40.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)1132356093Rat
738020Pia8Pristane induced arthritis QTL 84.7joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1165833076Rat
1578650Bmd6Bone mineral density QTL 612.2femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)150910843284926Rat
1578651Bmd7Bone mineral density QTL 714.2femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)150910843284926Rat
1578669Bss9Bone structure and strength QTL 96.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)150910843284926Rat
1554320Bmd1Bone mineral density QTL 112.20.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)150910886060548Rat
1600360Mcs16Mammary carcinoma susceptibility QTL 162.4mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1224439043433040Rat
1300170Rf6Renal function QTL 63.14renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)1416280711481482Rat
7421626Bp360Blood pressure QTL 3600.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1439328949393289Rat
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)15925874115540829Rat
4889451Eae29Experimental allergic encephalomyelitis QTL 295.51nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)1592587724697545Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 25600 UniSTS
NCBI Nucleotide AF054139
UniSTS 239694 UniSTS