VEGF_1127 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: VEGF_1127

Symbol: VEGF_1127
Previously known as:
RGD ID: 5506575
Expected Size: 824 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2914,969,190 - 14,970,014 (+)MAPPERmRatBN7.2
Rnor_6.0917,354,231 - 17,355,054NCBIRnor6.0
Rnor_5.0916,246,208 - 16,247,031UniSTSRnor5.0
RGSC_v3.4910,534,621 - 10,535,444UniSTSRGSC3.4
Celera912,715,315 - 12,716,138UniSTS
Cytogenetic Map9q12UniSTS
Is Marker For: Genes:   Vegfa  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TAATGTTATTGGTGTCTTCAC
Reverse Primer TTAACCAAGAATACTGAAAAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
619991Vegfavascular endothelial growth factor A91495530014970641Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
70226Eae4Experimental allergic encephalomyelitis QTL 4nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)9125661317Rat
9589055Scfw5Subcutaneous fat weight QTL 55.550.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)9137999212Rat
7411592Foco8Food consumption QTL 87.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)9137999212Rat
9589158Gluco65Glucose level QTL 656.820.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)9137999212Rat
1300124Cm4Cardiac mass QTL 43.55heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)9140594091Rat
1298088Edpm11Estrogen-dependent pituitary mass QTL 112.5pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)9143718459Rat
1641911Alcrsp13Alcohol response QTL 13response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)9143718459Rat
10054125Srcrt7Stress Responsive Cort QTL 73.330.0011blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)9187073594Rat
1331757Cdexp1CD45RC expression in CD8 T cells QTL 14.3CD8-positive T cell quantity (VT:0008077)blood CD45RC(high) CD8 T cell count to CD45RC(low) CD8 T cell count ratio (CMO:0001990)9102453767509080Rat
1354650Despr5Despair related QTL 54.010.0017locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)9125408446254084Rat
2303559Gluco54Glucose level QTL 542blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)9125408446254084Rat
61425Cia15Collagen induced arthritis QTL 154.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)9510982642921101Rat
631211Bw4Body weight QTL45.31retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)9510982650109826Rat
11353947Bp392Blood pressure QTL 392arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)9728325252283252Rat
61450Ciaa3CIA Autoantibody QTL 36.5blood autoantibody amount (VT:0003725)calculated serum anti-type 2 collagen antibody titer (CMO:0001279)9795472022071169Rat
9589133Insul26Insulin level QTL 2617.960.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)9895256053952560Rat
7411609Foco16Food consumption QTL 1625.60.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)9895256053952560Rat
1600365Mcs20Mammary carcinoma susceptibility QTL 203mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)91353377042791750Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 83785 UniSTS
UniSTS 277860 UniSTS