PMC58788P1 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: PMC58788P1

Symbol: PMC58788P1
Previously known as:
RGD ID: 5504706
Expected Size: 113 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21518,080,715 - 18,080,828 (+)MAPPERmRatBN7.2
mRatBN7.21517,360,870 - 17,360,983 (-)MAPPERmRatBN7.2
mRatBN7.21518,080,715 - 18,080,828 (-)MAPPERmRatBN7.2
mRatBN7.21517,360,870 - 17,360,983 (+)MAPPERmRatBN7.2
Rnor_6.01519,196,173 - 19,196,285NCBIRnor6.0
Rnor_6.01518,095,360 - 18,095,472NCBIRnor6.0
Rnor_5.01523,162,577 - 23,162,689UniSTSRnor5.0
Rnor_5.01522,072,833 - 22,072,945UniSTSRnor5.0
RGSC_v3.41519,346,122 - 19,346,234UniSTSRGSC3.4
RGSC_v3.41520,065,990 - 20,066,102UniSTSRGSC3.4
Celera1517,316,433 - 17,316,545UniSTS
Cytogenetic Map15p14UniSTS
Is Marker For: Genes:   Ptgdr   Ptgdrl1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTTGGGAAGTTCGTGCAGTACT
Reverse Primer GCCATGAGGCTGGAGTAGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
619707Ptgdrprostaglandin D2 receptor151736030417367679Rat
1359579Spetex2fSpetex-2F protein151771631517720203Rat
1561032Dlgap5l2DLG associated protein 5 like 2151802953118036669Rat
1565108Ptgdrl1prostaglandin D2 receptor-like 1151807235718081452Rat
1589068Galnt12-ps4polypeptide N-acetylgalactosaminyltransferase 12, pseudogene 4151756320417564802Rat
1590180Rrs1-ps14ribosome biogenesis regulator 1 homolog, pseudogene 14151765358817662311Rat
6494161Galnt12-ps2polypeptide N-acetylgalactosaminyltransferase 12, pseudogene 2151804621018048369Rat
7619317LOC102554774disks large homolog 5-like151766257517669537Rat
7600849Glrx-ps16glutaredoxin, pseudogene 16151772928117733791Rat
7677163LOC102550211disks large homolog 5-like151773705717742754Rat
9305593Dlg5l9discs large MAGUK scaffold protein 5 like 9151792943017948524Rat
11474029Glrxl1glutaredoxin like 1151769492517700549Rat
11453876LOC108349347disks large homolog 5-like151763582417643786Rat
41113905Rrs1-ps5ribosome biogenesis regulator 1 homolog, pseudogene 5151796175917969281Rat
41118835LOC120093162disks large homolog 5-like151797642117983758Rat
41174358LOC120093146disks large homolog 5-like151788838917895433Rat
41329473LOC120093102disks large homolog 5-like151775971917791248Rat
41098740LOC120096937disks large homolog 5-like151767857017691607Rat
41376748LOC120096936disks large homolog 5-like151761346617621079Rat
41010761Galnt12-ps3polypeptide N-acetylgalactosaminyltransferase 12, pseudogene 3151776807117779005Rat
40980376LOC120096938disks large homolog 5-like151795423417961479Rat
40995200LOC120096933uncharacterized LOC120096933151730729017373486Rat
41080219LOC120096939disks large homolog 5-like151790761717914650Rat
41301532LOC120096940disks large homolog 5-like151805250718060069Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354657Despr13Despair related QTL 130.0022locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)15129912054Rat
8552920Pigfal8Plasma insulin-like growth factor 1 level QTL 83blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)15134723002Rat
8694361Abfw6Abdominal fat weight QTL 610.20.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)15134723002Rat
9589149Insul29Insulin level QTL 299.060.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)15134723002Rat
731170Pur3Proteinuria QTL 32.30.0005urine protein amount (VT:0005160)urine protein excretion rate (CMO:0000759)15141686771Rat
1641887Alcrsp14Alcohol response QTL 14response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)15142356671Rat
2298549Neuinf12Neuroinflammation QTL 123.5nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)15155302115Rat
10401805Kidm51Kidney mass QTL 51kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1530632945306329Rat
1641913Colcr2Colorectal carcinoma resistance QTL 26.570.0197intestine integrity trait (VT:0010554)colorectal tumor number (CMO:0001794)15226636822711984Rat
1641913Colcr2Colorectal carcinoma resistance QTL 26.570.0197intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)15226636822711984Rat
738017Hcas7Hepatocarcinoma susceptibility QTL 72.91liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)15226636846921453Rat
1582251Gluco24Glucose level QTL 243.20.0008blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)15553075650530756Rat
631273Lecl2Lens clarity QTL 20.001lens clarity trait (VT:0001304)age of onset/diagnosis of cataract (CMO:0001584)151059608955596089Rat
2300167Bmd63Bone mineral density QTL 635.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)151111114256111142Rat
2300173Bmd62Bone mineral density QTL 6212.80.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)151111114256111142Rat
2293688Bss29Bone structure and strength QTL 295.310.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)151111114256111142Rat
2317750Glom26Glomerulus QTL 264.3urine protein amount (VT:0005160)urine protein level (CMO:0000591)151249614165205939Rat
5685002Bss103Bone structure and strength QTL 1032.8tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)151448116528469888Rat
61424Scl1Serum cholesterol level QTL 17.70.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)151672552880672115Rat
1331729Rf42Renal function QTL 423.071kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)151736289773690657Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 498475 UniSTS
  63889 UniSTS
UniSTS 273373 UniSTS