AU049844 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: AU049844

Symbol: AU049844
Previously known as:
RGD ID: 5090593
Expected Size: 215 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.222,778,463 - 2,778,679 (+)MAPPERmRatBN7.2
mRatBN7.22751,149 - 751,362 (-)MAPPERmRatBN7.2
mRatBN7.22444,233 - 444,438 (+)MAPPERmRatBN7.2
mRatBN7.2228,789 - 28,998 (+)MAPPERmRatBN7.2
Rnor_6.012294,162 - 294,393NCBIRnor6.0
Rnor_6.0722,393,702 - 22,393,910NCBIRnor6.0
Rnor_5.012294,273 - 294,504UniSTSRnor5.0
Rnor_5.0722,559,955 - 22,560,163UniSTSRnor5.0


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCGATCTGCCCTTTTCTTTCT
Reverse Primer TATGAGTCTCAACCCCAGTGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
41035327LOC1201011645.8S ribosomal RNA26172761880Rat
11451091LOC108351591uncharacterized LOC108351591278346142640Rat
1590774Eif4g2l1eukaryotic translation initiation factor 4, gamma 2 like 127938582070Rat
40949604LOC1201011975.8S ribosomal RNA2372751372904Rat
41023188LOC120101110U2 spliceosomal RNA2557346557461Rat
41361939LOC1201011205.8S ribosomal RNA2590062590215Rat
40964049LOC1201011535.8S ribosomal RNA2719524719677Rat
41275654Ube2v1-ps16ubiquitin conjugating enzyme E2 V1, pseudogene 162729095738261Rat
40980396Nid2-ps3nidogen 2, pseudogene 32765398842505Rat
41373425LOC1201011315.8S ribosomal RNA2788239788392Rat
41310048Nid2-ps7nidogen 2, pseudogene 72814970820911Rat
41049275Uba52-ps23ubiquitin A-52 residue ribosomal protein fusion product 1, pseudogene 232875153876359Rat
41400565LOC1201013165.8S ribosomal RNA2954583954735Rat
1589412Uba52-ps20ubiquitin A-52 residue ribosomal protein fusion product 1, pseudogene 202982668983110Rat
9359793Uba52-ps4ubiquitin A-52 residue ribosomal protein fusion product 1, pseudogene 4210419721043213Rat
9084001LOC103691400ATP synthase-coupling factor 6, mitochondrial pseudogene210887171089035Rat
9365433LOC103691406ATP synthase-coupling factor 6, mitochondrial pseudogene212283891228868Rat
41385574LOC1201011425.8S ribosomal RNA212371821237334Rat
41327968Uba52-ps9ubiquitin A-52 residue ribosomal protein fusion product 1, pseudogene 9213318341332179Rat
41091787LOC1201013935.8S ribosomal RNA213628121362964Rat
41084998LOC120100641uncharacterized LOC120100641214596681476574Rat
41083049Vmn2r82lvomeronasal 2, receptor 82 like214885351493672Rat
6500747Ube2v1-ps24ubiquitin conjugating enzyme E2 V1, pseudogene 24220616602062357Rat
41207321LOC1201011095.8S ribosomal RNA220736122073764Rat
9213283LOC103691581ATP synthase-coupling factor 6, mitochondrial pseudogene221912582191581Rat
41212450Atp5pf-ps1ATP synthase peripheral stalk subunit F6, pseudogene 1223758342376433Rat
41201926LOC1201011865.8S ribosomal RNA224275762427728Rat
40956888Uba52-ps6ubiquitin A-52 residue ribosomal protein fusion product 1, pseudogene 6224630332463376Rat
6490713Nid2l1nidogen 2 like 1224907572492712Rat
40986280Uba52-ps15ubiquitin A-52 residue ribosomal protein fusion product 1, pseudogene 15225068032507237Rat
41131101Ube2v1-ps15ubiquitin conjugating enzyme E2 V1, pseudogene 15226586622659477Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631682Bp115Blood pressure QTL 1154.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2137410502Rat
738010Lnnr3Liver neoplastic nodule remodeling QTL 32.94liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)2141244106Rat


Additional Information

Database Acc Id Source(s)
UniSTS 146290 UniSTS