AU049785 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU049785

Symbol: AU049785
Previously known as:
RGD ID: 5090497
Expected Size: 263 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21498,037,278 - 98,037,539 (+)MAPPERmRatBN7.2
Rnor_6.014108,833,648 - 108,833,908NCBIRnor6.0
Rnor_5.014108,554,966 - 108,555,226UniSTSRnor5.0
RGSC_v3.414105,009,454 - 105,009,714UniSTSRGSC3.4
Celera1497,002,933 - 97,003,193UniSTS
Cytogenetic Map14q22UniSTS
Is Marker For: Genes:   Bcl11a  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CGATCCCTCTGACTTGGGTAA
Reverse Primer GATCCACACACAAAGGCTGTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1309923Bcl11aBCL11 transcription factor A149802901898124181Rat

Nucleotide Sequences
GenBank Nucleotide AU049785 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631523Pia13Pristane induced arthritis QTL 133.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)144079346098037301Rat
2300197Scl59Serum cholesterol level QTL 59blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1455147478100147478Rat
9590294Uminl4Urine mineral level QTL 45.660.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)1455624247100624247Rat
9589034Epfw11Epididymal fat weight QTL 1160.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1455624247100624247Rat
2317879Alcrsp27Alcohol response QTL 273.30.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1456631369101631369Rat
634328Hc5Hypercalciuria QTL 52.3urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1458184885103184885Rat
1582259Gluco23Glucose level QTL 233.10.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1470053989104886043Rat
1641900Alcrsp11Alcohol response QTL 11alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)1470053989104886043Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 305589 UniSTS
UniSTS 146231 UniSTS