AU048632 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: AU048632

Symbol: AU048632
Previously known as:
RGD ID: 5088543
Expected Size: 239 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21325,509,191 - 25,509,430 (+)MAPPERmRatBN7.2
mRatBN7.21559,579,861 - 59,580,084 (+)MAPPERmRatBN7.2
Rnor_6.01329,966,367 - 29,966,605NCBIRnor6.0
Rnor_6.01566,998,365 - 66,998,587NCBIRnor6.0
Rnor_5.01570,626,844 - 70,627,066UniSTSRnor5.0
Rnor_5.01335,096,934 - 35,097,172UniSTSRnor5.0
RGSC_v3.41565,752,609 - 65,752,831UniSTSRGSC3.4
RGSC_v3.41315,681,773 - 15,682,011UniSTSRGSC3.4
Celera1559,117,312 - 59,117,534UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CACTTCACTAACCCCATATCCAA
Reverse Primer GTGGAATCTCAGGGTTATTTTGATT
 

Region

Nucleotide Sequences
GenBank Nucleotide AU048632 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2317027Aia22Adjuvant induced arthritis QTL 222.29joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)13134266636Rat
738036Lnnr4Liver neoplastic nodule remodeling QTL 43.64liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)13142356786Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)131101056920Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131101056920Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131101056920Rat
631672Iddm12Insulin dependent diabetes mellitus QTL 122.20.0032blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)13599466834535351Rat
61339Bp24Blood pressure QTL 240.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)13599466844807491Rat
1581554Pur11Proteinuria QTL 11urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
1581573Uae36Urinary albumin excretion QTL 36urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)13599483377046787Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)138897350101631289Rat
7411662Foco29Food consumption QTL 2920.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)13931346554313465Rat
9589141Insul28Insulin level QTL 2810.820.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)13931346554313465Rat
2317040Aia21Adjuvant induced arthritis QTL 212.75joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)13983154154831541Rat
2317046Aia8Adjuvant induced arthritis QTL 83.9700000286102295joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)13983154154831541Rat
2317034Aia9Adjuvant induced arthritis QTL 94.62joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)131176653532331607Rat
2317044Aia23Adjuvant induced arthritis QTL 232.3joint integrity trait (VT:0010548)ankle joint diameter (CMO:0002148)131176653532331607Rat
1300163Cardf1Cardiac cell morphology QTL 14.18aorta morphology trait (VT:0000272)artery lesion measurement (CMO:0000975)131192944945417941Rat
2302275Gluco37Glucose level QTL 373.8blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)131192944946193066Rat
631645Bp121Blood pressure QTL 1213.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131491565559915655Rat
9589164Gluco66Glucose level QTL 666.670.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)131515872260158722Rat
1331784Bp222Blood pressure QTL 2222.944arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131769443653050594Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1320605871101339738Rat
61391Bp5Blood pressure QTL 55.6arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)132230187567301875Rat
70170Eae14Experimental allergic encephalomyelitis QTL 140.0024nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)132320344868203448Rat
6893338Cm76Cardiac mass QTL 7600.99heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)132369296968692969Rat
1558644Cm45Cardiac mass QTL 453.60.002heart mass (VT:0007028)heart wet weight (CMO:0000069)132369296968692969Rat
2317750Glom26Glomerulus QTL 264.3urine protein amount (VT:0005160)urine protein level (CMO:0000591)151249614165205939Rat
61424Scl1Serum cholesterol level QTL 17.70.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)151672552880672115Rat
1331729Rf42Renal function QTL 423.071kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)151736289773690657Rat
10054130Srcrt8Stress Responsive Cort QTL 82.180.0085blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)152211793367117933Rat
1578646Bmd18Bone mineral density QTL 185.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)152280624098288169Rat
1578647Bmd17Bone mineral density QTL 174femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)152280624098288169Rat
1578660Bss19Bone structure and strength QTL 194.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)152280624098288169Rat
1582214Stl21Serum triglyceride level QTL 213.10.022blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)152803066582262678Rat
1582227Gluco30Glucose level QTL 303.60.0003blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)152803066582262678Rat
1582228Epfw3Epididymal fat weight QTL 34.10.0002epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)152803066582262678Rat
1582242Gluco28Glucose level QTL 283.30.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)152803066582262678Rat
1582244Bw79Body weight QTL 7940.0002epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)152803066582262678Rat
2293691Bmd37Bone mineral density QTL 376.60.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)153361105871477291Rat
2293686Bmd36Bone mineral density QTL 367.40.0001femur strength trait (VT:0010010)femoral neck ultimate force (CMO:0001703)153361105871477291Rat
1598828Glom14Glomerulus QTL 142.5kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)153405413979054139Rat
1300144Rf23Renal function QTL 233.61renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)154063126898288169Rat
724545Niddm54Non-insulin dependent diabetes mellitus QTL 540.02blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)155079449473699215Rat
2317050Aia24Adjuvant induced arthritis QTL 242.06joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)155284790873690657Rat
1576315Schws6Schwannoma susceptibility QTL 60.0069nervous system integrity trait (VT:0010566)post-insult time of death (CMO:0002005)155380615298806152Rat
61477Aia4Adjuvant induced arthritis QTL 43joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)155559608991365858Rat
631516Gluco31Glucose level QTL 317blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)155559608995018120Rat
631655Bp126Blood pressure QTL 1264arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1558156477101769107Rat


Additional Information

Database Acc Id Source(s)
UniSTS 145082 UniSTS