BQ199385 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BQ199385

Symbol: BQ199385
Previously known as:
RGD ID: 5085705
Expected Size: 216 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2122,715,726 - 2,715,942 (-)MAPPERmRatBN7.2
Rnor_6.0122,430,121 - 2,430,336NCBIRnor6.0
Rnor_5.0124,583,811 - 4,584,026UniSTSRnor5.0
RGSC_v3.4121,427,871 - 1,428,086UniSTSRGSC3.4
Celera124,531,192 - 4,531,407UniSTS
RH 3.4 Map120.0UniSTS
Cytogenetic Map12p12UniSTS
Is Marker For: Genes:   Ccl25  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGAGTGGTAGGGCCTTTAGCAT
Reverse Primer GGATGGTGATGATGTCCAGAAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1305530Ccl25C-C motif chemokine ligand 251227073982716571Rat

Nucleotide Sequences
RefSeq Transcripts NM_001037203 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC107945 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300174Bw15Body weight QTL 152.93body mass (VT:0001259)body weight loss (CMO:0001399)1219318387Rat
2312418Kidm41Kidney mass QTL 413.70.0001kidney mass (VT:0002707)single kidney wet weight to body weight ratio (CMO:0000622)12119611090Rat
10755457Coatc14Coat color QTL 140.01759coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)12122591684Rat
6893681Bw109Body weight QTL 1092.30.004body mass (VT:0001259)body weight (CMO:0000012)12123297788Rat
1581516Cm56Cardiac mass QTL 564.20.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)12129333307Rat
1598855Bp294Blood pressure QTL 2943.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12134851688Rat
7411660Foco28Food consumption QTL 2810.90.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
9590086Insglur6Insulin/glucose ratio QTL 618.970.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)12142110980Rat
8694179Bw150Body weight QTL 1502.90.001body mass (VT:0001259)body weight gain (CMO:0000420)12142110980Rat
7411586Foco5Food consumption QTL 55.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
7411595Foco9Food consumption QTL 940.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
7411545Bw128Body weight QTL 1285.20.001body mass (VT:0001259)body weight gain (CMO:0000420)12142110980Rat
9590147Scort7Serum corticosterone level QTL 713.610.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)12142110980Rat
2303575Insul14Insulin level QTL 144blood insulin amount (VT:0001560)blood insulin level (CMO:0000349)12142450532Rat
737979Pia22Pristane induced arthritis QTL 2253.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)12144465750Rat
634351Apr5Acute phase response QTL 56.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)12144503507Rat
2302042Pia38Pristane induced arthritis QTL 383.50.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)12144503507Rat
7243862Mcs30Mammary carcinoma susceptibility QTL 308.62mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)127977298525593Rat
634350Apr4Acute phase response QTL 46orosomucoid 1 amount (VT:0010541)plasma orosomucoid 1 level (CMO:0001467)12117200546172005Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 360750 UniSTS
UniSTS 260877 UniSTS