AI013770 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AI013770

Symbol: AI013770
Previously known as:
RGD ID: 5084490
Expected Size: 118 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2173,704,578 - 3,704,696 (+)MAPPERmRatBN7.2
Rnor_6.0174,067,900 - 4,068,017NCBIRnor6.0
Rnor_5.0176,297,132 - 6,297,249UniSTSRnor5.0
RGSC_v3.4179,424,911 - 9,425,028UniSTSRGSC3.4
Celera173,833,495 - 3,833,612UniSTS
RH 3.4 Map1747.6UniSTS
Cytogenetic Map17p14UniSTS
Is Marker For: Genes:   Ctsql2   Ctsml1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTGAAAGCTCCCAGAATTCACA
Reverse Primer CATGACACTCCATTTCCTGAGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1303225Ctsql2cathepsin Q-like 21736989733704787Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
9590316Scort21Serum corticosterone level QTL 214.750.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)17122871563Rat
10401807Kidm52Kidney mass QTL 52kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)17131701463Rat
70184BpQTLcluster14Blood pressure QTL cluster 143.38arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)17131990913Rat
631207Niddm41Non-insulin dependent diabetes mellitus QTL 41blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)17137830672Rat
1354658Spl8Serum phospholipid level QTL 83.8blood VLDL phospholipid amount (VT:0010507)blood very low density lipoprotein phospholipid level (CMO:0001571)17160781592Rat
1354581Bp247Blood pressure QTL 2474.5arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)17169599340Rat
1354662Rf49Renal function QTL 492.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)17169599340Rat
1641902Colcr7Colorectal carcinoma resistance QTL 73.350.0044intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)17211514921881669Rat
1300123Bp194Blood pressure QTL 1942.82arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)17211514934551001Rat
631499Stl1Serum triglyceride level QTL 13.6blood triglyceride amount (VT:0002644)blood triglyceride level (CMO:0000118)17327139827389946Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 408201 UniSTS
  498689 UniSTS
UniSTS 250371 UniSTS