RH140156 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH140156

Symbol: RH140156
Previously known as:
RGD ID: 5078122
Expected Size: 201 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21172,562,547 - 72,562,748 (+)MAPPERmRatBN7.2
Rnor_6.01176,168,871 - 76,169,071NCBIRnor6.0
Rnor_5.01179,210,132 - 79,210,332UniSTSRnor5.0
RGSC_v3.41174,481,117 - 74,481,317UniSTSRGSC3.4
Celera1171,518,481 - 71,518,681UniSTS
Cytogenetic Map11q22UniSTS
Is Marker For: Genes:   Fgf12  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AATGTTTGTGGAGTCCCGATTT
Reverse Primer TCCACCCAATGAGAGAGAGAGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
620163Fgf12fibroblast growth factor 12117199715172564757Rat

Nucleotide Sequences
GenBank Nucleotide CH473999 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000241 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
724554Iddm17Insulin dependent diabetes mellitus QTL 170.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)111897620886241447Rat
724563Uae10Urinary albumin excretion QTL 106urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)112767241082846715Rat
1300110Stl7Serum triglyceride level QTL 74.64blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)112952841882566702Rat
2298551Neuinf10Neuroinflammation QTL 103.7nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)113123913478851519Rat
70180BpQTLcluster10Blood pressure QTL cluster 103.19arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)113491804179918041Rat
1300135Rf19Renal function QTL 193.38blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)114094618882566702Rat
2312566Glom20Glomerulus QTL 203.60.001kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)114428575982566702Rat
1581565Pur10Proteinuria QTL 100.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)114480331882846466Rat
1581572Uae35Urinary albumin excretion QTL 350.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)114480331882846466Rat
4889859Pur28Proteinuria QTL 2819.50.001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)114545932375190161Rat
724561Plsm4Polydactyly-luxate syndrome (PLS) morphotypes QTL 40.0003forelimb integrity trait (VT:0010562)front foot phalanges count (CMO:0001947)115445753486241447Rat
4889521Gluco62Glucose level QTL 622.820.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)115513672982993457Rat
7411658Foco27Food consumption QTL 2716.20.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)115635142486241447Rat
631506Bp104Blood pressure QTL 1042.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)115980279482566545Rat
70208Niddm22Non-insulin dependent diabetes mellitus QTL 223.61blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)115980279482566553Rat
10058954Gmadr7Adrenal mass QTL 72.490.0049adrenal gland mass (VT:0010420)both adrenal glands wet weight to body weight ratio (CMO:0002411)116034659086241447Rat
1549848Bvd6Brain ventricular dilatation QTL 63.10.0001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)116611332182169223Rat
634339Niddm50Non-insulin dependent diabetes mellitus QTL 503.32blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)116642214886241447Rat
1354593Stl12Serum triglyceride level QTL 123.36blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)116642214886241447Rat
1354656Bvd3Brain ventricular dilatation QTL 33.640.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)116944607082846715Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 170630 UniSTS
UniSTS 222235 UniSTS