RH139466 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH139466

Symbol: RH139466
Previously known as:
RGD ID: 5076938
Expected Size: 182 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2103,971,140 - 3,971,322 (+)MAPPERmRatBN7.2
Rnor_6.0103,925,841 - 3,926,022NCBIRnor6.0
Rnor_5.0102,792,589 - 2,792,770UniSTSRnor5.0
RGSC_v3.4103,849,651 - 3,849,832UniSTSRGSC3.4
Celera103,002,306 - 3,002,487UniSTS
Cytogenetic Map10q11UniSTS
Is Marker For: Genes:   Snx29  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGGTAGACACCCAGGACCTACA
Reverse Primer TCGTTCACCTTCATCTGACACA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1596162Snx29sorting nexin 291038848804298699Rat

Nucleotide Sequences
GenBank Nucleotide CH474017 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000240 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
634329Pia15Pristane induced arthritis QTL 153.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10124158324Rat
2293680Bss40Bone structure and strength QTL 405.660.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)10135225947Rat
634327Hc4Hypercalciuria QTL 42.4urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)10138328221Rat
7411611Foco17Food consumption QTL 1718.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)10142315980Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)10180676123Rat
10401803Kidm50Kidney mass QTL 50kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1041834445418344Rat
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1074336463851208Rat
1549898Neuinf3Neuroinflammation QTL 326.4nervous system integrity trait (VT:0010566)MHC Class II RT1A-positive spinal cord ventral horn area to total spinal cord ventral horn area ratio (CMO:0001980)1034063205387112Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 689142 UniSTS
UniSTS 221552 UniSTS