RH139345 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH139345

Symbol: RH139345
Previously known as: AI575351; 
RGD ID: 5076730
Expected Size: 184 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21867,352,741 - 67,352,925 (+)MAPPERmRatBN7.2
Rnor_6.01869,735,633 - 69,735,816NCBIRnor6.0
Rnor_5.01868,879,314 - 68,879,497UniSTSRnor5.0
RGSC_v3.41870,542,477 - 70,542,660UniSTSRGSC3.4
Celera1865,535,828 - 65,536,011UniSTS
RH 3.4 Map11665.0UniSTS


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATCCTCCTGCTTCTACCTGTCG
Reverse Primer ACTAGCAGCGGCATCCTATTTC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1310321Me2malic enzyme 2186735083367400987Rat

Nucleotide Sequences
GenBank Nucleotide DH731090 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1578661Bss20Bone structure and strength QTL 203.7femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)181179151883218561Rat
1578667Bss21Bone structure and strength QTL 213.5femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)181179151883218561Rat
1600373Mamtr6Mammary tumor resistance QTL 6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)181927890183218561Rat
1331741Bp232Blood pressure QTL 2323.59112arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)182137289383213037Rat
1331733Bp233Blood pressure QTL 2333.97196arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182479697779788953Rat
2325839Bp348Blood pressure QTL 3480.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182557098570570985Rat
2293704Bss35Bone structure and strength QTL 354.590.0002femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)182896485373964853Rat
2300157Bmd66Bone mineral density QTL 6613.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)182896485373964853Rat
2300177Bmd65Bone mineral density QTL 6519.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)182896485373964853Rat
9589816Gluco68Glucose level QTL 687.250.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)182979296574792965Rat
8694378Bw157Body weight QTL 1573.590.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)182979296574792965Rat
9590318Scort22Serum corticosterone level QTL 227.640.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)182979296574792965Rat
1331754Bp230Blood pressure QTL 2304.61609arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182979296574792965Rat
738005Anxrr11Anxiety related response QTL 113.4exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)183003981375039813Rat
61429Cia17Collagen induced arthritis QTL 174.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)183135940870263868Rat
2303120Mamtr8Mammary tumor resistance QTL 80.001mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)183135940883218561Rat
631274Sprol1Serum protein level QTL 15.3blood total protein amount (VT:0005567)serum total protein level (CMO:0000661)183139332077209694Rat
631518Bw11Body weight QTL 112.8body mass (VT:0001259)body weight (CMO:0000012)183587072380870723Rat
61367Iddm4Insulin dependent diabetes mellitus QTL 42.330.0074blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)183819245583192455Rat
1598826Anxrr20Anxiety related response QTL 203.04body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)184143297183828827Rat
6893683Bw110Body weight QTL 1102.70.002body mass (VT:0001259)body weight (CMO:0000012)184334502283828827Rat
8694366Abfw8Abdominal fat weight QTL 86.380.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)184664067583828827Rat
8694432Bw165Body weight QTL 1653.810.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)184664067583828827Rat
9589041Epfw12Epididymal fat weight QTL 1217.080.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)184664067583828827Rat
2303571Bw92Body weight QTL 923body mass (VT:0001259)body weight (CMO:0000012)184852004483828827Rat
2303584Gluco55Glucose level QTL 552blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)184852004483828827Rat
738008Hcar14Hepatocarcinoma resistance QTL 144.3liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion number (CMO:0001462)185146473383218561Rat
1359020Ppulsi2Prepulse inhibition QTL 22.71prepulse inhibition trait (VT:0003088)acoustic startle response measurement (CMO:0001519)185229287573997283Rat
631509Sald2Serum aldosterone level QTL 22.9blood aldosterone amount (VT:0005346)serum aldosterone level (CMO:0000487)185253976369140759Rat
12880368Bw187Body weight QTL 1870.045body mass (VT:0001259)body weight (CMO:0000012)185253976376104388Rat
12904067Cm122Cardiac mass QTL 1220.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)185253976376104388Rat
12904069Cm123Cardiac mass QTL 1230.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)185253976376104388Rat
12904070Cm124Cardiac mass QTL 1240.01heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)185253976376104388Rat
12904071Am18Aortic mass QTL 180.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)185253976376104388Rat
12904073Kidm71Kidney mass QTL 710.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)185253976376104388Rat
2301417Bp319Blood pressure QTL 3190.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)185253976376104388Rat
1298072Cia26Collagen induced arthritis QTL 263.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)185470976983828827Rat
724542Kidm2Kidney mass QTL 22.6kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)185917211583828827Rat
2312600Bp341Blood pressure QTL 3410.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)185933040970263868Rat
2301969Bp324Blood pressure QTL 3244.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)185971241776477814Rat
70185BpQTLcluster15Blood pressure QTL cluster 154.61arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)185971241776477814Rat
70185BpQTLcluster15Blood pressure QTL cluster 154.61arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)185971241776477814Rat
70185BpQTLcluster15Blood pressure QTL cluster 154.61arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)185971241776477814Rat
70185BpQTLcluster15Blood pressure QTL cluster 154.61arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)185971241776477814Rat
1331770Bp234Blood pressure QTL 2343.807arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)185979647871893566Rat
6903353Bp353Blood pressure QTL 3532.8arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)185979647883828827Rat
6903356Bp354Blood pressure QTL 3544.6arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)185979647883828827Rat
61384Bp48Blood pressure QTL 4819.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)186062231177209844Rat
631675Iddm15Insulin dependent diabetes mellitus QTL 15urine glucose amount (VT:0001758)percentage of study population developing diabetes mellitus during a period of time (CMO:0001114)186062231177209844Rat


Additional Information

Database Acc Id Source(s)
UniSTS 221431 UniSTS