RH136651 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH136651

Symbol: RH136651
Previously known as: AI511427; 
RGD ID: 5072100
Expected Size: 194 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2458,687,752 - 58,687,946 (+)MAPPERmRatBN7.2
Rnor_6.0457,360,134 - 57,360,327NCBIRnor6.0
Rnor_5.0457,121,867 - 57,122,060UniSTSRnor5.0
RGSC_v3.4456,972,319 - 56,972,512UniSTSRGSC3.4
Celera453,789,031 - 53,789,224UniSTS
RH 3.4 Map4318.6UniSTS
Cytogenetic Map4q22UniSTS
Is Marker For: Genes:   Nrf1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGAGGGCATTGGATTTGGATTA
Reverse Primer GGGAGAGGCAAGAGAATCACTC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1304603Nrf1nuclear respiratory factor 145866493258772328Rat

Nucleotide Sequences
GenBank Nucleotide CH473959 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000234 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
619616Bp79Blood pressure QTL 790.0292arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4521460278882945Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45214602146446691Rat
1358203Stl19Serum triglyceride level QTL 192.80.002blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4521829465958103Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)41081417091360527Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)411320076180699135Rat
2303585Bw86Body weight QTL 864body mass (VT:0001259)body weight (CMO:0000012)41467806559678065Rat
2313401Anxrr27Anxiety related response QTL 27aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)41793350862933508Rat
61412Pia2Pristane induced arthritis QTL 23.9joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)42133334362278020Rat
6909122Insul22Insulin level QTL 224.63blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)42690728575585128Rat
6909128Pancm4Pancreatic morphology QTL 411.35pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)42690728575585128Rat
8655906Rf60Renal function QTL 603.8blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)42949419581006281Rat
12798520Anxrr55Anxiety related response QTL 554.450.01locomotor behavior trait (VT:0001392)number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715)432583980114627242Rat
8552782Vie1Viral induced encephalitis QTL 126.4brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43443048482490359Rat
8552801Bw143Body weight QTL 1437.3body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)43443048482490359Rat
8552809Vie5Viral induced encephalitis QTL 525.3brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)43443048482490359Rat
8655961Kidm43Kidney mass QTL 4318kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)436303261103194984Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)438465774146803430Rat
61475Aia2Adjuvant induced arthritis QTL 25.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)43950527573892441Rat
1331807Rf31Renal function QTL 312.988urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)43952426474726312Rat
1300139Hrtrt6Heart rate QTL 62.85heart pumping trait (VT:2000009)heart rate (CMO:0000002)439524264116179656Rat
61445Strs3Sensitivity to stroke QTL 33cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)44043338885433388Rat
8694439Bw168Body weight QTL 1689.570.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)44043341485433414Rat
6893678Bw108Body weight QTL 1082.60.006body mass (VT:0001259)body weight (CMO:0000012)44345797688457976Rat
1576305Emca6Estrogen-induced mammary cancer QTL 65.8mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)444463720155883716Rat
1354612Foco1Food consumption QTL 18.87eating behavior trait (VT:0001431)food intake rate (CMO:0000427)444463908148090542Rat
1354660Salc1Saline consumption QTL 111.26drinking behavior trait (VT:0001422)saline drink intake rate (CMO:0001627)444463908148090542Rat
2312567Glom19Glomerulus QTL 191.90.006kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)445456990146803430Rat
1298082Stresp4Stress response QTL 4blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)450119848146803430Rat
4889969Bss96Bone structure and strength QTL 964.9tibia size trait (VT:0100001)tibia cortical bone volume (CMO:0001725)45664777678882945Rat
4889972Bss97Bone structure and strength QTL 975.6tibia size trait (VT:0100001)tibia total bone volume (CMO:0001724)45664777678882945Rat
5685009Bmd86Bone mineral density QTL 863.7tibia mineral mass (VT:1000283)bone mineral density (CMO:0001226)45664777678882945Rat
5685012Bmd87Bone mineral density QTL 875.1tibia mineral mass (VT:1000283)bone mineral content (CMO:0001554)45664777678882945Rat
70200Alc18Alcohol consumption QTL 189.2drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)456647873149491524Rat
1641833Alc21Alcohol consumption QTL 218.60.0001drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)456698790126192555Rat
634311Sach7Saccharin preference QTL 7taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)45711443281266970Rat
631546Bp86Blood pressure QTL 863.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45711443291360801Rat
61336Bp21Blood pressure QTL 214.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45711470578881294Rat
1358363Sradr3Stress Responsive Adrenal Weight QTL 36.19adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)457486946102486946Rat
1558651Swd3Spike wave discharge measurement QTL 34.620.000024brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge frequency (CMO:0001742)45843213392991462Rat
631671Iddm11Insulin dependent diabetes mellitus QTL 113.60.0012blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)45863587778886137Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 312195 UniSTS
UniSTS 218742 UniSTS