AV218859 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AV218859

Symbol: AV218859
Previously known as:
RGD ID: 5070468
Expected Size: 146 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2641,300,936 - 41,301,082 (+)MAPPERmRatBN7.2
Rnor_6.0643,845,038 - 43,845,183NCBIRnor6.0
Rnor_5.0660,716,521 - 60,716,666UniSTSRnor5.0
RGSC_v3.4642,311,314 - 42,311,459UniSTSRGSC3.4
Celera640,588,615 - 40,588,760UniSTS
Cytogenetic Map6q16UniSTS
Is Marker For: Genes:   Cys1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ACCTGCAAATGATTCCATGA
Reverse Primer TTGCTAGCTCTGGGAGGTTT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1596023Cys1cystin 164130083641318071Rat

Nucleotide Sequences
RefSeq Transcripts NM_001109597 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide AV218859 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2293709Bss23Bone structure and strength QTL 235.180.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)6142487980Rat
2293650Bss31Bone structure and strength QTL 315.050.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)6142487980Rat
2293656Bss28Bone structure and strength QTL 286.790.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)6142487980Rat
7411584Foco4Food consumption QTL 44.30.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)6142838846Rat
738024Sach5Saccharine consumption QTL 53.90.00039consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)6143394190Rat
2301972Bp325Blood pressure QTL 3254.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)6172227641Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6507449754641141Rat
4145119Mcs25Mammary carcinoma susceptibility QTL 250.0001mammary gland integrity trait (VT:0010552)ratio of deaths to total study population during a period of time (CMO:0001023)610894415110548006Rat
1578665Bss16Bone structure and strength QTL 164.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)61173566972593685Rat
1578668Bmd14Bone mineral density QTL 143.8femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)61173566972593685Rat
10401812Kidm54Kidney mass QTL 54kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
10401800Kidm49Kidney mass QTL 49kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
1576309Emca7Estrogen-induced mammary cancer QTL 74mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)615107216107351382Rat
2292589Emca10Estrogen-induced mammary cancer QTL 100.048mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)61653614061536140Rat
1354664Slep2Serum leptin concentration QTL 24.49blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)61653614071636405Rat
1641898Colcr4Colorectal carcinoma resistance QTL43.710.0007intestine integrity trait (VT:0010554)well differentiated malignant colorectal tumor surface area measurement (CMO:0002077)62033877762613667Rat
2293839Kiddil2Kidney dilation QTL 24.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62086642281133036Rat
2293841Kiddil4Kidney dilation QTL 44.4kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62086642281133036Rat
1331779Rf38Renal function QTL 382.876kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)63207442872227641Rat
634318Bw118Body weight QTL 1183.55abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)63330954957730294Rat
6893340Cm77Cardiac mass QTL 770.260.57heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)63330954981132889Rat
1300143Rf14Renal function QTL 142.92renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)63443413777102317Rat
1354632Scl29Serum cholesterol level QTL 293.74blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)63509870971636405Rat
634307Bp141Blood pressure QTL 1414arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)63523041780230417Rat
70199Coreg1Compensatory renal growth QTL 111.8kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)63569161857730540Rat
9590290Uminl2Urine mineral level QTL 23.960.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)63878398983783989Rat
9590306Scort18Serum corticosterone level QTL 182.880.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)63878398983783989Rat
9590140Scort4Serum corticosterone level QTL 414.490.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)63878398983783989Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 690489 UniSTS
UniSTS 165813 UniSTS