AU047531 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: AU047531

Symbol: AU047531
Previously known as:
RGD ID: 5067796
Expected Size: 129 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21389,816,395 - 89,816,526 (+)MAPPERmRatBN7.2
mRatBN7.22025,810,188 - 25,810,368 (+)MAPPERmRatBN7.2
Rnor_6.02027,414,075 - 27,414,254NCBIRnor6.0
Rnor_6.01395,960,581 - 95,960,709NCBIRnor6.0
Rnor_5.02029,244,863 - 29,245,042UniSTSRnor5.0
Rnor_5.013100,403,134 - 100,403,262UniSTSRnor5.0
RGSC_v3.41393,728,191 - 93,728,319UniSTSRGSC3.4
RGSC_v3.42025,156,792 - 25,156,971UniSTSRGSC3.4
Celera2027,106,183 - 27,106,362UniSTS
Celera1389,378,451 - 89,378,579UniSTS
Cytogenetic Map20p11UniSTS
Is Marker For: Genes:   Tet1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCCCTAGGCGGTAGTTACCA
Reverse Primer ATCTGGTTCTATTGCCCTCAAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1565309Catsperecatsper channel auxiliary subunit epsilon138979966989954723Rat
1310993Tet1tet methylcytosine dioxygenase 1202576104225840926Rat

Nucleotide Sequences
GenBank Nucleotide AU047531 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)131101056920Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)131101056920Rat
1354666Bp244Blood pressure QTL 2444.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)131101056920Rat
1581570Eae17Experimental allergic encephalomyelitis QTL 174.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)138897350101631289Rat
7207885Glom27Glomerulus QTL 273.9kidney glomerulus integrity trait (VT:0010546)kidney crescentic glomeruli count to kidney normal glomeruli count ratio (CMO:0002139)1320605871101339738Rat
1354621Rf47Renal function QTL 473.7kidney renin amount (VT:0010559)kidney renin level (CMO:0002166)1330395351101056920Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)133124133193395974Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)133124133193395974Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)133124133193395974Rat
70181BpQTLcluster11Blood pressure QTL cluster 116.922arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)133124133193395974Rat
12879444Bp397Blood pressure QTL 397arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134504940490049404Rat
12879471Bp398Blood pressure QTL 398arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134551471990514719Rat
12879441Bp396Blood pressure QTL 396arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)134569998390699983Rat
1298066Bp159Blood pressure QTL 1590.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)134608804691088046Rat
1641901Alcrsp6Alcohol response QTL 6response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)135236217197362171Rat
1354655Bp241Blood pressure QTL 2413.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1356056920101056920Rat
12879475Bp400Blood pressure QTL 400arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1361825626106807694Rat
2293702Bss34Bone structure and strength QTL 344.610.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1365103704106807694Rat
2293687Bss26Bone structure and strength QTL 264.60.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)1365103704106807694Rat
8655959Pur32Proteinuria QTL 328.4urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)137402391897213863Rat
2293341Glom15Glomerulus QTL 159.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)1374862117101339893Rat
4889606Gluco63Glucose level QTL 632.860.003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1380753256106807694Rat
2317851Alcrsp22Alcohol response QTL 223.20.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)20127339237Rat
1641893Alcrsp7Alcohol response QTL 7response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)20127339237Rat
8694189Bw153Body weight QTL 1533.130.001body mass (VT:0001259)body weight gain (CMO:0000420)20129191651Rat
9590275Scort15Serum corticosterone level QTL 153.480.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)20129191651Rat
7411650Foco23Food consumption QTL 2320.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)20129191651Rat
9590109Sffal8Serum free fatty acids level QTL 85.320.01blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)20129191651Rat
9589155Insul32Insulin level QTL 326.380.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)20129191651Rat
6893685Bw111Body weight QTL 1112.70.004body mass (VT:0001259)body weight (CMO:0000012)20132578807Rat
7411668Foco32Food consumption QTL 3280.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)20136600972Rat
9590252Scort12Serum corticosterone level QTL 1220.460.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)20136600972Rat
2305926Iddm37Insulin dependent diabetes mellitus QTL 376blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)20152784246527842Rat
1641915Colcr9Colorectal carcinoma resistance QTL 92.970.0024intestine integrity trait (VT:0010554)benign colorectal tumor number (CMO:0001795)20153065546530655Rat
1598816Memor12Memory QTL 122.4exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)20260683647606836Rat
2317057Aia27Adjuvant induced arthritis QTL 272.83joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)20289259726381954Rat
4889870Pur30Proteinuria QTL 30190.005urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)20804241029322208Rat
7411652Foco24Food consumption QTL 240.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)201175751554435887Rat
9590092Insglur9Insulin/glucose ratio QTL 918.380.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)201175751554435887Rat
4889610Pancm3Pancreatic morphology QTL 33.750.001pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)201761783247606836Rat
2317880Alcrsp25Alcohol response QTL 252.3response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)201769755054435887Rat
2303626Vencon10Ventilatory control QTL 100.001respiration trait (VT:0001943)respiration rate (CMO:0000289)201919072154435887Rat
2303578Gluco50Glucose level QTL 502blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)202510672254435887Rat
2303587Bw93Body weight QTL 9313body mass (VT:0001259)body weight (CMO:0000012)202510672254435887Rat
2300188Bmd68Bone mineral density QTL 686.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)202510672254435887Rat
1331747Hrtrt16Heart rate QTL 163.163heart pumping trait (VT:2000009)heart rate (CMO:0000002)202520973454435887Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 309902 UniSTS
UniSTS 110417 UniSTS