AU047600 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU047600

Symbol: AU047600
Previously known as:
RGD ID: 5067680
Expected Size: 169 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2934,759,659 - 34,759,825 (-)MAPPERmRatBN7.2
Rnor_6.0939,696,010 - 39,696,175NCBIRnor6.0
Rnor_5.0939,366,544 - 39,366,709UniSTSRnor5.0
RGSC_v3.4931,246,578 - 31,246,743UniSTSRGSC3.4
Celera932,559,074 - 32,559,239UniSTS
Cytogenetic Map9q21UniSTS
Is Marker For: Genes:   Khdrbs2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGGTTTGGGTTCAGTTTTTGTT
Reverse Primer ACATTGTTGTAGTTTGTGAACCACA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
621738Khdrbs2KH RNA binding domain containing, signal transduction associated 293444702334953684Rat

Nucleotide Sequences
GenBank Nucleotide AU047600 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  DH644571 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
9589055Scfw5Subcutaneous fat weight QTL 55.550.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)9137999212Rat
7411592Foco8Food consumption QTL 87.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)9137999212Rat
9589158Gluco65Glucose level QTL 656.820.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)9137999212Rat
1300124Cm4Cardiac mass QTL 43.55heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)9140594091Rat
1298088Edpm11Estrogen-dependent pituitary mass QTL 112.5pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)9143718459Rat
1641911Alcrsp13Alcohol response QTL 13response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)9143718459Rat
10054125Srcrt7Stress Responsive Cort QTL 73.330.0011blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)9187073594Rat
1331757Cdexp1CD45RC expression in CD8 T cells QTL 14.3CD8-positive T cell quantity (VT:0008077)blood CD45RC(high) CD8 T cell count to CD45RC(low) CD8 T cell count ratio (CMO:0001990)9102453767509080Rat
1354650Despr5Despair related QTL 54.010.0017locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)9125408446254084Rat
2303559Gluco54Glucose level QTL 542blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)9125408446254084Rat
61425Cia15Collagen induced arthritis QTL 154.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)9510982642921101Rat
631211Bw4Body weight QTL45.31retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)9510982650109826Rat
11353947Bp392Blood pressure QTL 392arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)9728325252283252Rat
9589133Insul26Insulin level QTL 2617.960.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)9895256053952560Rat
7411609Foco16Food consumption QTL 1625.60.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)9895256053952560Rat
1600365Mcs20Mammary carcinoma susceptibility QTL 203mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)91353377042791750Rat
724543Cm20Cardiac mass QTL 203.9heart mass (VT:0007028)calculated heart weight (CMO:0000073)91696139840594091Rat
631680Cm11Cardiac mass QTL 113.10.00089heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)92043051965430519Rat
70186Niddm26Non-insulin dependent diabetes mellitus QTL 263.87blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)92207116986369743Rat
631643Bp120Blood pressure QTL 12030.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)92207120067071200Rat
1598823Memor16Memory QTL 161.9exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)92213332249968732Rat
7207805Bmd88Bone mineral density QTL 884femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)92375402458157242Rat
1300180Bw14Body weight QTL 143.776body mass (VT:0001259)body weight (CMO:0000012)92375402461381613Rat
7207814Bmd91Bone mineral density QTL 913.5femur size trait (VT:1000369)femoral neck cross-sectional area (CMO:0001697)92375414483851531Rat
70218Cm28Cardiac mass QTL 288.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)92526804479271759Rat
724544Uae9Urinary albumin excretion QTL 94.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)925268044114175309Rat
731164Uae25Urinary albumin excretion QTL 253.50.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)925661188100929786Rat
1641894Alcrsp12Alcohol response QTL 12response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)92746863972468639Rat
7411656Foco26Food consumption QTL 269.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)93253550577535505Rat
7411571Bw138Body weight QTL 13814.30.001body mass (VT:0001259)body weight gain (CMO:0000420)93253550577535505Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 170843 UniSTS
UniSTS 110348 UniSTS