AU048079 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU048079

Symbol: AU048079
Previously known as:
RGD ID: 5066908
Expected Size: 148 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2102,978,661 - 2,978,809 (+)MAPPERmRatBN7.2
Rnor_6.0102,423,939 - 2,424,086NCBIRnor6.0
Rnor_5.0101,305,175 - 1,305,322UniSTSRnor5.0
RGSC_v3.4102,683,654 - 2,683,801UniSTSRGSC3.4


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCCCCAGAATCTGGCCTA
Reverse Primer TTTACAGTGCTTTTTTGGTGGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
11483725LOC108352046uncharacterized LOC1083520461029295502980410Rat

Nucleotide Sequences
GenBank Nucleotide AU048079 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH616899.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
634329Pia15Pristane induced arthritis QTL 153.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10124158324Rat
2293680Bss40Bone structure and strength QTL 405.660.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)10135225947Rat
634327Hc4Hypercalciuria QTL 42.4urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)10138328221Rat
7411611Foco17Food consumption QTL 1718.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)10142315980Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)10180676123Rat
10401803Kidm50Kidney mass QTL 50kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1041834445418344Rat
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1074336463851208Rat


Additional Information

Database Acc Id Source(s)
UniSTS 109893 UniSTS