BE121006 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: BE121006

Symbol: BE121006
Previously known as:
RGD ID: 5065148
Expected Size: 160 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21452,536,199 - 52,536,359 (+)MAPPERmRatBN7.2
mRatBN7.2X127,902,305 - 127,902,465 (+)MAPPERmRatBN7.2
Rnor_6.0X135,564,508 - 135,564,667NCBIRnor6.0
Rnor_6.01454,713,963 - 54,714,122NCBIRnor6.0
Rnor_5.01454,848,626 - 54,848,785UniSTSRnor5.0
Rnor_5.0X135,634,659 - 135,634,818UniSTSRnor5.0
RGSC_v3.4X135,127,481 - 135,127,640UniSTSRGSC3.4
RGSC_v3.41456,669,488 - 56,669,647UniSTSRGSC3.4
Celera1451,715,893 - 51,716,052UniSTS
CeleraX126,849,765 - 126,849,924UniSTS
Cytogenetic Map14q11UniSTS
Is Marker For: Genes:   Pcdh7  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGTATTGTTTAATTTGGCCAGGG
Reverse Primer GGACACCATTGGGCTATCTCTC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1303209Pcdh7protocadherin 7145247180152901696Rat

Nucleotide Sequences
GenBank Nucleotide CH473991 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000251 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1581500Renag1Renal agenesis QTL 1kidney development trait (VT:0000527)percentage of study population developing unilateral renal agenesis during a period of time (CMO:0000940)14817066868298175Rat
1358296Ael3Aortic elastin QTL 33.70.00051aorta elastin amount (VT:0003905)aortic elastin14826709053267090Rat
2302045Pia39Pristane induced arthritis QTL 394.90.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G2a level (CMO:0002116)14826709053267090Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141103062295876975Rat
2313397Coatc1Coat color QTL1coat/hair pigmentation trait (VT:0010463)coat/hair color measurement (CMO:0001808)141854133263541332Rat
10755459Coatc15Coat color QTL 150.01681coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)141983694464836944Rat
70187Pancm5Pancreatic morphology QTL 516.7pancreas mass (VT:0010144)pancreas weight to body weight ratio (CMO:0000630)143032009280829842Rat
1300154Bp189Blood pressure QTL 1893.04arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)143088377768757901Rat
2313048Bss84Bone structure and strength QTL 843.10.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143766971982669719Rat
2313084Bss83Bone structure and strength QTL 832.90.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143766971982669719Rat
2313089Bss81Bone structure and strength QTL 813.40.0001body length (VT:0001256)body length, nose to rump (CMO:0000079)143766971982669719Rat
2313100Bss82Bone structure and strength QTL 8230.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143766971982669719Rat
738037Hcas6Hepatocarcinoma susceptibility QTL 62.93liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)143905723783368335Rat
70214Niddm28Non-insulin dependent diabetes mellitus QTL 284.06blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)143999825175582726Rat
631523Pia13Pristane induced arthritis QTL 133.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)144079346098037301Rat
1300136Rf22Renal function QTL 223.9renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)144226252995023211Rat
1549834Scl45Serum cholesterol level QTL 455.8blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)145002321195023211Rat
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X41052407146860749Rat
1598872Memor14Memory QTL 144.5exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X93956491138956491Rat
738025Stresp3Stress response QTL 34.610.0066stress-related behavior trait (VT:0010451)defensive burying - approachX100567703150256146Rat
1598809Memor15Memory QTL 154.4exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X103312877148312877Rat
1598856Memor1Memory QTL 11.9exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)X103312877148312877Rat
738029Stresp2Stress response QTL 23.40.0004stress-related behavior trait (VT:0010451)defensive burying - approachX112934952138400867Rat
10059603Bw174Body weight QTL 1743.40.025body mass (VT:0001259)body weight (CMO:0000012)X113937816152453651Rat
634346Insul4Insulin level QTL 40blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)X126975089152453651Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 360942 UniSTS
UniSTS 247996 UniSTS