Marker: BE108164 |
Symbol: |
BE108164 |
Previously known as: |
|
RGD ID: |
5064592 |
Expected Size: |
0 (bp) |
Position |
Rat Assembly | Chr | Position (strand) | Source | JBrowse |
---|
mRatBN7.2 | 11 | 85,321,228 - 85,322,091 (+) | MAPPER | mRatBN7.2 | mRatBN7.2 | 11 | 85,321,936 - 85,322,091 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | 11 | 89,574,682 - 89,574,836 | NCBI | Rnor6.0 | Rnor_6.0 | 11 | 89,573,974 - 89,574,836 | NCBI | Rnor6.0 | Rnor_5.0 | 11 | 92,629,005 - 92,629,159 | UniSTS | Rnor5.0 | Rnor_5.0 | 11 | 92,628,297 - 92,629,159 | UniSTS | Rnor5.0 | RGSC_v3.4 | 11 | 87,232,525 - 87,233,387 | UniSTS | RGSC3.4 | RGSC_v3.4 | 11 | 87,233,233 - 87,233,387 | UniSTS | RGSC3.4 | Celera | 11 | 84,062,060 - 84,062,213 | UniSTS | | Celera | 11 | 84,061,352 - 84,062,213 | UniSTS | | Cytogenetic Map | 11 | q23 | UniSTS | |
|
Is Marker For: |
Genes:
Ube2v2
|
Annotation
Strains and Sequence
Sequence
|
Forward Primer |
GGGATTTAGCTCAGTGGTACCTAGC |
Reverse Primer |
TTGTTATAGGCACCATTTGTGTCA |
|
Region
Genes in Region
727838 | Ube2v2 | ubiquitin conjugating enzyme E2 V2 | 11 | 85304528 | 85338430 | Rat | |
QTLs in Region (mRatBN7.2)
724554 | Iddm17 | Insulin dependent diabetes mellitus QTL 17 | | 0.001 | blood glucose amount (VT:0000188) | blood glucose level (CMO:0000046) | 11 | 18976208 | 86241447 | Rat | 724561 | Plsm4 | Polydactyly-luxate syndrome (PLS) morphotypes QTL 4 | | 0.0003 | forelimb integrity trait (VT:0010562) | front foot phalanges count (CMO:0001947) | 11 | 54457534 | 86241447 | Rat | 7411658 | Foco27 | Food consumption QTL 27 | 16.2 | 0.001 | eating behavior trait (VT:0001431) | feed conversion ratio (CMO:0001312) | 11 | 56351424 | 86241447 | Rat | 10058954 | Gmadr7 | Adrenal mass QTL 7 | 2.49 | 0.0049 | adrenal gland mass (VT:0010420) | both adrenal glands wet weight to body weight ratio (CMO:0002411) | 11 | 60346590 | 86241447 | Rat | 634339 | Niddm50 | Non-insulin dependent diabetes mellitus QTL 50 | 3.32 | | blood glucose amount (VT:0000188) | plasma glucose level (CMO:0000042) | 11 | 66422148 | 86241447 | Rat | 1354593 | Stl12 | Serum triglyceride level QTL 12 | 3.36 | | blood triglyceride amount (VT:0002644) | serum triglyceride level (CMO:0000360) | 11 | 66422148 | 86241447 | Rat | |