BI278109 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: BI278109

Symbol: BI278109
Previously known as:
RGD ID: 5058874
Expected Size: 189 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21772,300,251 - 72,300,440 (+)MAPPERmRatBN7.2
Rnor_6.01776,249,841 - 76,250,029NCBIRnor6.0
Rnor_5.01777,889,977 - 77,890,165UniSTSRnor5.0
Celera1771,754,990 - 71,755,178UniSTS
RH 3.4 Map17717.0UniSTS
Cytogenetic Map17q12.3UniSTS
Is Marker For: Genes:   Upf2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCCTGTTGACCTGACCTGATTC
Reverse Primer TAGCAACATTCCTCACCACCAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1309178Upf2UPF2, regulator of nonsense mediated mRNA decay177222457572335896Rat

Nucleotide Sequences
GenBank Nucleotide FT167461 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  JH619090.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
8552928Pigfal9Plasma insulin-like growth factor 1 level QTL 99blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)172840914773409147Rat
9590107Sffal7Serum free fatty acids level QTL 74.810.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)172840914773409147Rat
2324621Coatc5Coat color QTL 5coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)173136839173951021Rat
724549Niddm56Non-insulin dependent diabetes mellitus QTL 560.03blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)173199078476990784Rat
1354663Bvd5Brain ventricular dilatation QTL 53.510.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)173199078481292925Rat
1300148Bp192Blood pressure QTL 1923.47arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)173455084373951021Rat
2301412Kidm40Kidney mass QTL 400.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)173747984782479847Rat
2317054Aia12Adjuvant induced arthritis QTL 124.24joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)173828150983281509Rat
2317060Aia26Adjuvant induced arthritis QTL 263.22joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)173828150983281509Rat
1598871Memor5Memory QTL 55.3exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)174054004180387013Rat
1358295Aocep1Aortic cell protein QTL 16.10.00000071thoracic aorta cellular protein amount (VT:0010598)aortic cell percentage174099000585990005Rat
7411575Bw140Body weight QTL 14030.20.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
8694181Bw151Body weight QTL 1514.360.001body mass (VT:0001259)body weight gain (CMO:0000420)174856093586533673Rat
2317038Ginf3Gastrointestinal inflammation QTL 32.890.005liver integrity trait (VT:0010547)liver granuloma severity score (CMO:0002157)174992015486533673Rat
2303580Gluco49Glucose level QTL 492blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)175004027186533673Rat
4889894Eae33Experimental allergic encephalomyelitis QTL 335.20.0001nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)175090909986022412Rat
1354588Bvd4Brain ventricular dilatation QTL 45.310.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)175349882882479847Rat
2302365Gluco40Glucose level QTL 404.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)175724684382046127Rat
7488963Bp369Blood pressure QTL 3690.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)175900564977910000Rat
2317045Aia11Adjuvant induced arthritis QTL 114.06joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)176078142686533673Rat
7411577Bw141Body weight QTL 1410.001body mass (VT:0001259)body weight gain (CMO:0000420)176261951686533673Rat
1300131Bp193Blood pressure QTL 1933.3arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)176364000973951021Rat
631502Cm26Cardiac mass QTL 263.71heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)176570358081153923Rat
1300129Rf25Renal function QTL 253.03blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)177100332581153923Rat
12904736Cm121Cardiac mass QTL 1210.043heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)177177462182479847Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 361271 UniSTS
UniSTS 244238 UniSTS