RH144582 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH144582

Symbol: RH144582
Previously known as: AW528138; 
RGD ID: 5056791
Expected Size: 171 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21410,367,242 - 10,367,413 (+)MAPPERmRatBN7.2
Rnor_6.01412,015,701 - 12,015,871NCBIRnor6.0
Rnor_5.01411,957,383 - 11,957,553UniSTSRnor5.0
RGSC_v3.41411,680,702 - 11,680,872UniSTSRGSC3.4
Celera1410,464,286 - 10,464,456UniSTS
Is Marker For: Genes:   Rasgef1b  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTGATTGGGCCACAGGTTATTT
Reverse Primer GCCACATTGGTATGATCTCTGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1562220Rasgef1bRasGEF domain family, member 1B14985951210380044Rat

Nucleotide Sequences
GenBank Nucleotide CH474022 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2300159Bmd61Bone mineral density QTL 615.30.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14126541967Rat
2300183Bmd60Bone mineral density QTL 605.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14126541967Rat
619619Rf4Renal disease susceptibility QTL 44.10.002urine total protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)14132754612Rat
634352Apr6Acute phase response QTL 63.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)14141131407Rat
71115Niddm15Non-insulin dependent diabetes mellitus QTL 154.8blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)14121760611030812Rat
70204Niddm20Non-insulin dependent diabetes mellitus QTL 205.10.000008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)14121760616960180Rat
2293089Iddm31Insulin dependent diabetes mellitus QTL 314.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)14381307418274691Rat
2293089Iddm31Insulin dependent diabetes mellitus QTL 314.7blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)14381307418274691Rat
1300114Srn2Serum renin concentration QTL 23.27blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)14381307421217635Rat
70195Mcs8Mammary carcinoma susceptibility QTL 84.28mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)14381307424531477Rat
1331740Bw26Body weight QTL 263.028body mass (VT:0001259)body weight (CMO:0000012)14381307430767156Rat
1581500Renag1Renal agenesis QTL 1kidney development trait (VT:0000527)percentage of study population developing unilateral renal agenesis during a period of time (CMO:0000940)14817066868298175Rat
1358296Ael3Aortic elastin QTL 33.70.00051aorta elastin amount (VT:0003905)aortic elastin14826709053267090Rat
2302045Pia39Pristane induced arthritis QTL 394.90.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G2a level (CMO:0002116)14826709053267090Rat
731183Pia20Pristane induced arthritis QTL 203.55joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)14908897839057237Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100361238 UniSTS
UniSTS 233827 UniSTS