RH142547 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH142547

Symbol: RH142547
Previously known as: AI138065; 
RGD ID: 5053263
Expected Size: 285 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.215,665,544 - 5,665,829 (+)MAPPERmRatBN7.2
Rnor_6.015,382,161 - 5,382,445NCBIRnor6.0
Rnor_5.017,033,934 - 7,034,218UniSTSRnor5.0
RGSC_v3.415,985,301 - 5,985,585UniSTSRGSC3.4
Celera14,188,251 - 4,188,535UniSTS
RH 3.4 Map1106.5UniSTS
Cytogenetic Map1p13UniSTS
Is Marker For: Genes:   Fbxo30  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GAGTGCTGTGCAGCCAAATA
Reverse Primer ATGATGGCCTTAATGGGTGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1359367Fbxo30F-box protein 30156553415671558Rat

Nucleotide Sequences
GenBank Nucleotide CH473994 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000231 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1354647Despr8Despair related QTL 80.0000341locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)1124744506Rat
2298546Neuinf4Neuroinflammation QTL 45.1nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)1128736750Rat
2313053Bss51Bone structure and strength QTL 513.80.0001tibia length (VT:0004357)tibia length (CMO:0000450)1132356093Rat
2313070Bss52Bone structure and strength QTL 524.40.0001body length (VT:0001256)body length (CMO:0000013)1132356093Rat
2313090Bmd69Bone mineral density QTL 694.40.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)1132356093Rat
738020Pia8Pristane induced arthritis QTL 84.7joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1165833076Rat
1578650Bmd6Bone mineral density QTL 612.2femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)150910843284926Rat
1578651Bmd7Bone mineral density QTL 714.2femur mineral mass (VT:0010011)compact volumetric bone mineral density (CMO:0001730)150910843284926Rat
1578669Bss9Bone structure and strength QTL 96.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)150910843284926Rat
1554320Bmd1Bone mineral density QTL 112.20.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)150910886060548Rat
1600360Mcs16Mammary carcinoma susceptibility QTL 162.4mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1224439043433040Rat
1300170Rf6Renal function QTL 63.14renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)1416280711481482Rat
7421626Bp360Blood pressure QTL 3600.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1439328949393289Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 308283 UniSTS
UniSTS 231794 UniSTS