AW555094 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AW555094

Symbol: AW555094
Previously known as:
RGD ID: 5051533
Expected Size: 83 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.245,173,854 - 5,173,937 (-)MAPPERmRatBN7.2
mRatBN7.2223,610,614 - 23,610,697 (+)MAPPERmRatBN7.2
Rnor_6.0221,959,350 - 21,959,432NCBIRnor6.0
Rnor_6.043,086,611 - 3,086,693NCBIRnor6.0
Rnor_5.043,139,041 - 3,139,123UniSTSRnor5.0
Rnor_5.0241,162,919 - 41,163,001UniSTSRnor5.0
RGSC_v3.4222,828,910 - 22,828,992UniSTSRGSC3.4
RGSC_v3.44415,262 - 415,344UniSTSRGSC3.4
Celera45,137,637 - 5,137,719UniSTS
Celera219,700,526 - 19,700,608UniSTS
Cytogenetic Map2q12UniSTS
Is Marker For: Genes:   Dhfr  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AATCTTCCACCTGCTCTCGT
Reverse Primer GCAAAGCTCTGCTCACTCAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2500Dhfrdihydrofolate reductase22358587623611199Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631682Bp115Blood pressure QTL 1154.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)2137410502Rat
738010Lnnr3Liver neoplastic nodule remodeling QTL 32.94liver integrity trait (VT:0010547)liver remodeling tumorous lesion number (CMO:0001461)2141244106Rat
61355Bp36Blood pressure QTL 362.9blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)25873687102844969Rat
1600379Mcs18Mammary carcinoma susceptibility QTL 182.6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)2788777242804738Rat
738012Anxrr3Anxiety related response QTL 33.8exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)2902351954023519Rat
10755430Coatc6Coat color QTL 60.02576coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)21159110056591100Rat
1578664Bmd9Bone mineral QTL density 95femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)21185206249003364Rat
731184Mamtr4Mammary tumor resistance QTL 40.0003mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)21649174061491740Rat
1357990Ael1Aortic elastin QTL 13.10.00091aorta elastin amount (VT:0003905)aortic elastin21907682564076825Rat
731167Glom4Glomerulus QTL 42.40.0082kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)22030467265304672Rat
2300168Bmd47Bone mineral density QTL 476.60.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)22066244865662448Rat
61351Bp33Blood pressure QTL 330.0018arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4127716890Rat
61408Scl23Serum cholesterol level QTL 230.0005blood HDL phospholipid amount (VT:0010504)serum high density lipoprotein phospholipid level (CMO:0001567)4127716890Rat
724557Plsm1Polydactyly-luxate syndrome (PLS) morphotypes QTL 10.0003forelimb integrity trait (VT:0010562)front foot phalanges count (CMO:0001947)4127716890Rat
1641905Colcr1Colorectal carcinoma resistance QTL 14.30.0003intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)4129494328Rat
61333Gluco16Glucose level QTL 164.30.00001adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)4130372989Rat
9589097Slep11Serum leptin concentration QTL 115.090.001blood leptin amount (VT:0005667)plasma leptin level (CMO:0000781)4131934116Rat
8552903Pigfal2Plasma insulin-like growth factor 1 level QTL 27.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)4131934116Rat
9589046Scfw2Subcutaneous fat weight QTL 25.540.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)4131934116Rat
9590100Sffal4Serum free fatty acids level QTL 47.360.05blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)4131934116Rat
738021Hcar13Hepatocarcinoma resistance QTL 134.3liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)4132584199Rat
1357341Gluco5Glucose level QTL 56.4adipocyte free fatty acid secretion trait (VT:0010465)absolute change in adipocyte free fatty acid secretion per unit volume (CMO:0001446)4133250345Rat
1357343Gluco4Glucose level QTL 40.00002adipocyte glucose uptake trait (VT:0004185)adipocyte maximal glucose uptake to basal glucose uptake ratio (CMO:0000874)4133250345Rat
61415Eae11Experimental allergic encephalomyelitis QTL 112.9nervous system integrity trait (VT:0010566)post-insult time to onset of experimental autoimmune encephalomyelitis (CMO:0001422)4139505420Rat
634323Hc2Hypercalciuria QTL 22.15urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)421079645210796Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 24312 UniSTS
UniSTS 180571 UniSTS