RH133064 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH133064

Symbol: RH133064
Previously known as:
RGD ID: 5048716
Expected Size: 210 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2122,777,024 - 2,777,234 (-)MAPPERmRatBN7.2
mRatBN7.21710,021,906 - 10,022,116 (+)MAPPERmRatBN7.2
Rnor_6.01710,558,768 - 10,558,977NCBIRnor6.0
Rnor_6.0124,546,604 - 4,546,813NCBIRnor6.0
Rnor_5.01712,684,766 - 12,684,975UniSTSRnor5.0
Rnor_5.0126,674,667 - 6,674,876UniSTSRnor5.0
RGSC_v3.41716,083,907 - 16,084,116UniSTSRGSC3.4
RGSC_v3.4121,366,613 - 1,366,822UniSTSRGSC3.4
Celera124,592,000 - 4,592,209UniSTS
Celera1710,094,872 - 10,095,081UniSTS
Cytogenetic Map12p12UniSTS
Cytogenetic Map17p14UniSTS
Is Marker For: Genes:   Nop16   Higd2a   Higd2al1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AATAGAAGCATGCAACCCAACA
Reverse Primer CTGAGTGTATGGCTGGGTCTTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1586494Higd2al1HIG1 hypoxia inducible domain family, member 2A-like 11227770942777581Rat
1309691Higd2aHIG1 hypoxia inducible domain family, member 2A171002185310022777Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300174Bw15Body weight QTL 152.93body mass (VT:0001259)body weight loss (CMO:0001399)1219318387Rat
2312418Kidm41Kidney mass QTL 413.70.0001kidney mass (VT:0002707)single kidney wet weight to body weight ratio (CMO:0000622)12119611090Rat
10755457Coatc14Coat color QTL 140.01759coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)12122591684Rat
6893681Bw109Body weight QTL 1092.30.004body mass (VT:0001259)body weight (CMO:0000012)12123297788Rat
1581516Cm56Cardiac mass QTL 564.20.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)12129333307Rat
1598855Bp294Blood pressure QTL 2943.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12134851688Rat
7411660Foco28Food consumption QTL 2810.90.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
9590086Insglur6Insulin/glucose ratio QTL 618.970.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)12142110980Rat
8694179Bw150Body weight QTL 1502.90.001body mass (VT:0001259)body weight gain (CMO:0000420)12142110980Rat
7411586Foco5Food consumption QTL 55.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
7411595Foco9Food consumption QTL 940.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12142110980Rat
7411545Bw128Body weight QTL 1285.20.001body mass (VT:0001259)body weight gain (CMO:0000420)12142110980Rat
9590147Scort7Serum corticosterone level QTL 713.610.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)12142110980Rat
2303575Insul14Insulin level QTL 144blood insulin amount (VT:0001560)blood insulin level (CMO:0000349)12142450532Rat
737979Pia22Pristane induced arthritis QTL 2253.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)12144465750Rat
634351Apr5Acute phase response QTL 56.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)12144503507Rat
2302042Pia38Pristane induced arthritis QTL 383.50.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)12144503507Rat
7243862Mcs30Mammary carcinoma susceptibility QTL 308.62mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)127977298525593Rat
634350Apr4Acute phase response QTL 46orosomucoid 1 amount (VT:0010541)plasma orosomucoid 1 level (CMO:0001467)12117200546172005Rat
9590316Scort21Serum corticosterone level QTL 214.750.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)17122871563Rat
10401807Kidm52Kidney mass QTL 52kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)17131701463Rat
70184BpQTLcluster14Blood pressure QTL cluster 143.38arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)17131990913Rat
631207Niddm41Non-insulin dependent diabetes mellitus QTL 41blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)17137830672Rat
1354658Spl8Serum phospholipid level QTL 83.8blood VLDL phospholipid amount (VT:0010507)blood very low density lipoprotein phospholipid level (CMO:0001571)17160781592Rat
1354581Bp247Blood pressure QTL 2474.5arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)17169599340Rat
1354662Rf49Renal function QTL 492.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)17169599340Rat
1641902Colcr7Colorectal carcinoma resistance QTL 73.350.0044intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)17211514921881669Rat
1300123Bp194Blood pressure QTL 1942.82arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)17211514934551001Rat
631499Stl1Serum triglyceride level QTL 13.6blood triglyceride amount (VT:0002644)blood triglyceride level (CMO:0000118)17327139827389946Rat
2324619Coatc4Coat color QTL 40.001coat/hair pigmentation trait (VT:0010463)pigmented coat/hair area to total coat/hair area ratio (CMO:0001810)17429913021293263Rat
2324619Coatc4Coat color QTL 40.001coat/hair pigmentation trait (VT:0010463)pigmented dorsal coat/hair area to total dorsal coat/hair area ratio (CMO:0001811)17429913021293263Rat
1354613Kidm14Kidney mass QTL 146.2kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)17429913035837242Rat
1354596Bw32Body weight QTL 324.5body mass (VT:0001259)body weight (CMO:0000012)17429913060781592Rat
1354630Cm34Cardiac mass QTL 348.7heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)17429913069599340Rat
1354638Insul1Insulin level QTL 14.8blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)17429913069599340Rat
1354651Lmblg2Limb length QTL 26tibia length (VT:0004357)tibia length (CMO:0000450)17429913069599340Rat
2293648Bmd31Bone mineral density QTL 314.50.0001femur size trait (VT:1000369)femoral neck cortical cross-sectional area (CMO:0001702)17435448727028127Rat
2293664Bmd28Bone mineral density QTL 285.10.0001femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)17435448727028127Rat
2303627Vencon8Ventilatory control QTL 80.001respiration trait (VT:0001943)tidal volume (CMO:0000222)17452803849528038Rat
10054088Scort28Serum corticosterone level QTL 282.040.0102blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)17452803849528038Rat
1581553Pur14Proteinuria QTL 145.30.0001urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)17797996816317111Rat
2303561Bw91Body weight QTL 912body mass (VT:0001259)body weight (CMO:0000012)17886846253868462Rat
1582199Insul5Insulin level QTL 53.40.0119blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)17920136523653323Rat
1582208Kidm32Kidney mass QTL 323.90.0018kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)17920136523653323Rat
1582224Epfw4Epididymal fat weight QTL 43.50.0058epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)17920136523653323Rat
1582225Bw67Body weight QTL 676.20.0001body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
1582226Bw64Body weight QTL 644.20.0017body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
1582241Bw70Body weight QTL 704.60.0003body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
1582245Bw73Body weight QTL 734.60.0004body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
1582258Bw76Body weight QTL 764.60.0005body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
2300002Iddm36Insulin dependent diabetes mellitus QTL 361.98blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)17999128640540197Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 290999 UniSTS
  306768 UniSTS
  688606 UniSTS
UniSTS 216347 UniSTS