RH131620 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH131620

Symbol: RH131620
Previously known as: AI072121; 
RGD ID: 5046208
Expected Size: 188 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.22046,938,437 - 46,938,625 (+)MAPPERmRatBN7.2
Rnor_6.02048,192,481 - 48,192,668NCBIRnor6.0
Rnor_5.02049,851,237 - 49,851,424UniSTSRnor5.0
RGSC_v3.42047,359,564 - 47,359,751UniSTSRGSC3.4
Celera2053,049,803 - 53,049,990UniSTS
RH 3.4 Map334.8UniSTS
Cytogenetic Map20q13UniSTS
Is Marker For: Genes:   Pdss2  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCAAATCTGACAAGACACTCACG
Reverse Primer AGCTGCAGGTGTCAGGAGAAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1359372Pdss2decaprenyl diphosphate synthase subunit 2204670963146938704Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1598816Memor12Memory QTL 122.4exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)20260683647606836Rat
7411652Foco24Food consumption QTL 240.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)201175751554435887Rat
9590092Insglur9Insulin/glucose ratio QTL 918.380.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)201175751554435887Rat
4889610Pancm3Pancreatic morphology QTL 33.750.001pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)201761783247606836Rat
2317880Alcrsp25Alcohol response QTL 252.3response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)201769755054435887Rat
2303626Vencon10Ventilatory control QTL 100.001respiration trait (VT:0001943)respiration rate (CMO:0000289)201919072154435887Rat
2303578Gluco50Glucose level QTL 502blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)202510672254435887Rat
2303587Bw93Body weight QTL 9313body mass (VT:0001259)body weight (CMO:0000012)202510672254435887Rat
2300188Bmd68Bone mineral density QTL 686.40.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)202510672254435887Rat
1331747Hrtrt16Heart rate QTL 163.163heart pumping trait (VT:2000009)heart rate (CMO:0000002)202520973454435887Rat
1598869Memor6Memory QTL 63.1exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)202924438854435887Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 365592 UniSTS
UniSTS 214903 UniSTS