RH131040 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH131040

Symbol: RH131040
Previously known as: AI045831; 
RGD ID: 5045198
Expected Size: 192 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.24120,070,738 - 120,070,930 (+)MAPPERmRatBN7.2
Rnor_6.04119,515,090 - 119,515,281NCBIRnor6.0
Rnor_5.04184,767,789 - 184,767,980UniSTSRnor5.0
RGSC_v3.44121,797,193 - 121,797,384UniSTSRGSC3.4
Celera4109,037,985 - 109,038,176UniSTS
RH 3.4 Map4711.2UniSTS
Cytogenetic Map4q34UniSTS
Is Marker For: Genes:   Aplf  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GACACACATATGCAGTCGTGGA
Reverse Primer AACAAATGACAGCCAGCAGTGT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1565557Aplfaprataxin and PNKP like factor4120070471120122656Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)411320076180699135Rat
731165Uae21Urinary albumin excretion QTL 212.40.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)4106649412151649412Rat
737821Hcar9Hepatocarcinoma resistance QTL 93.7liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)4109866907167139601Rat
1298082Stresp4Stress response QTL 4blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)450119848146803430Rat
631646Stl4Serum triglyceride level QTL 46.50.0001blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)473169846132642728Rat
631662Hcar2Hepatocarcinoma resistance QTL 23.10.0003liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)478878504123878504Rat
631674Iddm14Insulin dependent diabetes mellitus QTL 14blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)464528739157573521Rat
631689Scl4Serum cholesterol level QTL 41.90.008blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)495174120140174120Rat
6478760Anxrr45Anxiety related response QTL 450.06717locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110870972155870972Rat
6478763Anxrr46Anxiety related response QTL 460.07428locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4110870972155870972Rat
738009Sach4Saccharine consumption QTL 44.90.000016consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)459948935154902892Rat
738015Pia9Pristane induced arthritis QTL 94.50.048joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)480694870125694870Rat
738016Alc16Alcohol consumption QTL 163.60.00015consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)459948935154902892Rat
738031Alc14Alcohol consumption QTL 147.60.00003consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)459948935154902892Rat
634334Xhs3X-ray hypersensitivity QTL 310intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)484728680129854654Rat
7207480Bss105Bone structure and strength QTL 1058.1femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)4109827074154827074Rat
1300116Hrtrt5Heart rate QTL 53.76heart pumping trait (VT:2000009)heart rate (CMO:0000002)4116179486151161268Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)438465774146803430Rat
1331802Srn5Serum renin concentration QTL 53.045renin activity (VT:0005581)plasma renin activity level (CMO:0000116)4119428175157578333Rat
1354612Foco1Food consumption QTL 18.87eating behavior trait (VT:0001431)food intake rate (CMO:0000427)444463908148090542Rat
1354660Salc1Saline consumption QTL 111.26drinking behavior trait (VT:0001422)saline drink intake rate (CMO:0001627)444463908148090542Rat
1358202Gluco11Glucose level QTL 112.40.02adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)485379421167139601Rat
1549832Bss3Bone structure and strength QTL 311femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)4109827074154827074Rat
1578655Bmd11Bone mineral density QTL 1111femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)490850165135850165Rat
1582232Gluco25Glucose level QTL 253.60.0023blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)485253748148090731Rat
1641919Alc22Alcohol consumption QTL 220.0005drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)481192555126192555Rat
1576305Emca6Estrogen-induced mammary cancer QTL 65.8mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)444463720155883716Rat
1576316Ept5Estrogen-induced pituitary tumorigenesis QTL 53.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)483428419177635233Rat
1641833Alc21Alcohol consumption QTL 218.60.0001drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)456698790126192555Rat
1578662Bss15Bone structure and strength QTL 1519.6femur width (VT:1000666)femoral neck width (CMO:0001695)487327165132327165Rat
1578670Bss14Bone structure and strength QTL 1416.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)487327165132327165Rat
61330Eau1Experimental allergic uveoretinitis QTL 10.0003uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)470362013132642728Rat
61406Scwia1Streptococcal cell wall induced arthritis QTL 12.3joint integrity trait (VT:0010548)experimental arthritis severity measurement (CMO:0001459)4106805662151805662Rat
61418Pia5Pristane induced arthritis QTL 54.5joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)462277855128289560Rat
61434Cia3Collagen induced arthritis QTL 34.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)4103194656148194656Rat
70177Xhs1X-ray hypersensitivity QTL 125.1intestine integrity trait (VT:0010554)post-insult time to onset of moribundity (CMO:0001896)482798864152731274Rat
70200Alc18Alcohol consumption QTL 189.2drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)456647873149491524Rat
61476Aia3Adjuvant induced arthritis QTL 33.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)486730991131730991Rat
2302049Pia32Pristane induced arthritis QTL 325.10.001blood autoantibody amount (VT:0003725)serum immunoglobulin G-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002112)4105789505150789505Rat
2306899Bp338Blood pressure QTL 3380.071arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)481006124120102625Rat
1331759Hrtrt13Heart rate QTL 133.54628heart pumping trait (VT:2000009)heart rate (CMO:0000002)4110275411168266883Rat
724535Cm18Cardiac mass QTL 182.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)4118856416163856416Rat
2312567Glom19Glomerulus QTL 191.90.006kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)445456990146803430Rat
12798519Anxrr54Anxiety related response QTL 542.540.05locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4114627026159627026Rat
12798527Anxrr58Anxiety related response QTL 584.110.05locomotor behavior trait (VT:0001392)distance moved per unit of time into, out of or within a discrete space in an experimental apparatus (CMO:0001493)4119463257147278687Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45214602146446691Rat
12798523Anxrr56Anxiety related response QTL 562.830.05locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)485253748150276390Rat
634335Anxrr16Anxiety related response QTL 167.22locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)493308457167139447Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 500247 UniSTS
UniSTS 214323 UniSTS