RH130359 Marker Search Result - Rat Genome Database

General

Marker: RH130359

Symbol:

RH130359

Previously known as:

AI029093;

RGD ID:

5044012

Expected Size:

186 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	20	25,330,161 - 25,330,347 (-)	MAPPER	mRatBN7.2
Rnor_6.0	20	26,830,885 - 26,831,070	NCBI	Rnor6.0
Rnor_5.0	20	8,138,768 - 8,138,953	UniSTS	Rnor5.0
RGSC_v3.4	20	25,665,528 - 25,665,713	UniSTS	RGSC3.4
Celera	20	26,628,245 - 26,628,430	UniSTS
Cytogenetic Map	20	p11	UniSTS

Is Marker For:

Genes: Herc4

Annotation

References - curated

#	Reference Title	Reference Citation
1.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	TATTGGCAGGCCCATAGTTTGT
Reverse Primer	GAACCATGAATTGTACCATCCTCA

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1310971	Herc4	HECT and RLD domain containing E3 ubiquitin protein ligase 4	20	25329972	25404657	Rat

Nucleotide Sequences


GenBank Nucleotide	JH619590.1	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
2317851	Alcrsp22	Alcohol response QTL 22	3.2	0.05	response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	20	1	27339237	Rat
1641893	Alcrsp7	Alcohol response QTL 7			response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	20	1	27339237	Rat
8694189	Bw153	Body weight QTL 153	3.13	0.001	body mass (VT:0001259)	body weight gain (CMO:0000420)	20	1	29191651	Rat
9590275	Scort15	Serum corticosterone level QTL 15	3.48	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	20	1	29191651	Rat
7411650	Foco23	Food consumption QTL 23	20.7	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	20	1	29191651	Rat
9590109	Sffal8	Serum free fatty acids level QTL 8	5.32	0.01	blood free fatty acid amount (VT:0001553)	plasma free fatty acids level (CMO:0000546)	20	1	29191651	Rat
9589155	Insul32	Insulin level QTL 32	6.38	0.001	blood insulin amount (VT:0001560)	plasma insulin level (CMO:0000342)	20	1	29191651	Rat
6893685	Bw111	Body weight QTL 111	2.7	0.004	body mass (VT:0001259)	body weight (CMO:0000012)	20	1	32578807	Rat
7411668	Foco32	Food consumption QTL 32	8	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	20	1	36600972	Rat
9590252	Scort12	Serum corticosterone level QTL 12	20.46	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	20	1	36600972	Rat
2305926	Iddm37	Insulin dependent diabetes mellitus QTL 37	6		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	20	1527842	46527842	Rat
1641915	Colcr9	Colorectal carcinoma resistance QTL 9	2.97	0.0024	intestine integrity trait (VT:0010554)	benign colorectal tumor number (CMO:0001795)	20	1530655	46530655	Rat
1598816	Memor12	Memory QTL 12	2.4		exploratory behavior trait (VT:0010471)	average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)	20	2606836	47606836	Rat
2317057	Aia27	Adjuvant induced arthritis QTL 27	2.83		joint integrity trait (VT:0010548)	right rear ankle joint diameter (CMO:0002150)	20	2892597	26381954	Rat
4889870	Pur30	Proteinuria QTL 30	19	0.005	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	20	8042410	29322208	Rat
7411652	Foco24	Food consumption QTL 24		0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	20	11757515	54435887	Rat
9590092	Insglur9	Insulin/glucose ratio QTL 9	18.38	0.001	blood insulin amount (VT:0001560)	calculated plasma insulin level (CMO:0002170)	20	11757515	54435887	Rat
4889610	Pancm3	Pancreatic morphology QTL 3	3.75	0.001	pancreas mass (VT:0010144)	pancreas wet weight (CMO:0000626)	20	17617832	47606836	Rat
2317880	Alcrsp25	Alcohol response QTL 25	2.3		response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	20	17697550	54435887	Rat
2303626	Vencon10	Ventilatory control QTL 10		0.001	respiration trait (VT:0001943)	respiration rate (CMO:0000289)	20	19190721	54435887	Rat
2303578	Gluco50	Glucose level QTL 50	2		blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	20	25106722	54435887	Rat
2303587	Bw93	Body weight QTL 93	13		body mass (VT:0001259)	body weight (CMO:0000012)	20	25106722	54435887	Rat
2300188	Bmd68	Bone mineral density QTL 68	6.4	0.0001	femur mineral mass (VT:0010011)	volumetric bone mineral density (CMO:0001553)	20	25106722	54435887	Rat
1331747	Hrtrt16	Heart rate QTL 16	3.163		heart pumping trait (VT:2000009)	heart rate (CMO:0000002)	20	25209734	54435887	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	309758	UniSTS
UniSTS	213643	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: RH130359