RH130049 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH130049

Symbol: RH130049
Previously known as: AA997553; 
RGD ID: 5043480
Expected Size: 241 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21715,990,519 - 15,990,760 (+)MAPPERmRatBN7.2
Rnor_6.01714,824,829 - 14,825,069NCBIRnor6.0
Rnor_5.01716,875,902 - 16,876,142UniSTSRnor5.0
RGSC_v3.41721,993,873 - 21,994,113UniSTSRGSC3.4
Celera1715,717,149 - 15,717,389UniSTS
RH 3.4 Map17183.4UniSTS
Cytogenetic Map17p14UniSTS
Is Marker For: Genes:   Barx1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCTGATCTGCTAGAGACGATTC
Reverse Primer AGTCTGGGAGAGTTGTGTTCAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1310884Barx1BARX homeobox 1171599041215993887Rat

Nucleotide Sequences
RefSeq Transcripts NM_001108880 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide JH618920.1 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
9590316Scort21Serum corticosterone level QTL 214.750.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)17122871563Rat
10401807Kidm52Kidney mass QTL 52kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)17131701463Rat
70184BpQTLcluster14Blood pressure QTL cluster 143.38arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)17131990913Rat
631207Niddm41Non-insulin dependent diabetes mellitus QTL 41blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)17137830672Rat
1354658Spl8Serum phospholipid level QTL 83.8blood VLDL phospholipid amount (VT:0010507)blood very low density lipoprotein phospholipid level (CMO:0001571)17160781592Rat
1354581Bp247Blood pressure QTL 2474.5arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)17169599340Rat
1354662Rf49Renal function QTL 492.9blood creatinine amount (VT:0005328)plasma creatinine level (CMO:0000537)17169599340Rat
1641902Colcr7Colorectal carcinoma resistance QTL 73.350.0044intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)17211514921881669Rat
1300123Bp194Blood pressure QTL 1942.82arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)17211514934551001Rat
631499Stl1Serum triglyceride level QTL 13.6blood triglyceride amount (VT:0002644)blood triglyceride level (CMO:0000118)17327139827389946Rat
2324619Coatc4Coat color QTL 40.001coat/hair pigmentation trait (VT:0010463)pigmented coat/hair area to total coat/hair area ratio (CMO:0001810)17429913021293263Rat
2324619Coatc4Coat color QTL 40.001coat/hair pigmentation trait (VT:0010463)pigmented dorsal coat/hair area to total dorsal coat/hair area ratio (CMO:0001811)17429913021293263Rat
1354613Kidm14Kidney mass QTL 146.2kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)17429913035837242Rat
1354596Bw32Body weight QTL 324.5body mass (VT:0001259)body weight (CMO:0000012)17429913060781592Rat
1354630Cm34Cardiac mass QTL 348.7heart left ventricle mass (VT:0007031)heart left ventricle wet weight (CMO:0000071)17429913069599340Rat
1354638Insul1Insulin level QTL 14.8blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)17429913069599340Rat
1354651Lmblg2Limb length QTL 26tibia length (VT:0004357)tibia length (CMO:0000450)17429913069599340Rat
2293648Bmd31Bone mineral density QTL 314.50.0001femur size trait (VT:1000369)femoral neck cortical cross-sectional area (CMO:0001702)17435448727028127Rat
2293664Bmd28Bone mineral density QTL 285.10.0001femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)17435448727028127Rat
2303627Vencon8Ventilatory control QTL 80.001respiration trait (VT:0001943)tidal volume (CMO:0000222)17452803849528038Rat
10054088Scort28Serum corticosterone level QTL 282.040.0102blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)17452803849528038Rat
1581553Pur14Proteinuria QTL 145.30.0001urine total protein amount (VT:0000032)urine protein excretion rate (CMO:0000759)17797996816317111Rat
2303561Bw91Body weight QTL 912body mass (VT:0001259)body weight (CMO:0000012)17886846253868462Rat
1582199Insul5Insulin level QTL 53.40.0119blood insulin amount (VT:0001560)calculated serum insulin level (CMO:0000359)17920136523653323Rat
1582208Kidm32Kidney mass QTL 323.90.0018kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)17920136523653323Rat
1582224Epfw4Epididymal fat weight QTL 43.50.0058epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)17920136523653323Rat
1582225Bw67Body weight QTL 676.20.0001body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
1582226Bw64Body weight QTL 644.20.0017body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
1582241Bw70Body weight QTL 704.60.0003body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
1582245Bw73Body weight QTL 734.60.0004body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
1582258Bw76Body weight QTL 764.60.0005body mass (VT:0001259)body weight (CMO:0000012)17920136523653323Rat
2300002Iddm36Insulin dependent diabetes mellitus QTL 361.98blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)17999128640540197Rat
1549900Iddm20Insulin dependent diabetes mellitus QTL 203.7pancreas integrity trait (VT:0010560)percentage of study population developing diabetes mellitus during a period of time (CMO:0001114)171398677321975515Rat
1331720Rf43Renal function QTL 432.881kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)171533061323017269Rat
1331765Hrtrt15Heart rate QTL 154.094heart pumping trait (VT:2000009)heart rate (CMO:0000002)171533061355836425Rat
1354640Scl32Serum cholesterol level QTL 325.4blood HDL cholesterol amount (VT:0000184)blood high density lipoprotein cholesterol level (CMO:0000052)171578159260781592Rat
1354659Scl68Serum cholesterol level QTL 683.9blood VLDL cholesterol amount (VT:0005144)blood very low density lipoprotein cholesterol level (CMO:0000648)171578159260781592Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 364680 UniSTS
UniSTS 213337 UniSTS