RH129865 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH129865

Symbol: RH129865
Previously known as: AA997350; 
RGD ID: 5043158
Expected Size: 217 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2341,526,193 - 41,526,401 (-)MAPPERmRatBN7.2
mRatBN7.21830,155,317 - 30,155,534 (+)MAPPERmRatBN7.2
Rnor_6.01831,468,273 - 31,468,489NCBIRnor6.0
Rnor_6.0341,526,254 - 41,526,461NCBIRnor6.0
Rnor_5.0346,603,180 - 46,603,387UniSTSRnor5.0
Rnor_5.01831,146,865 - 31,147,081UniSTSRnor5.0
RGSC_v3.4338,693,669 - 38,693,876UniSTSRGSC3.4
Celera339,624,389 - 39,624,596UniSTS
Celera1829,796,050 - 29,796,266UniSTS
Cytogenetic Map18p11UniSTS
Is Marker For: Genes:   Rnf14  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GAGCTGACAGTTAAGCAATCCT
Reverse Primer ACAGCAGTGTTTGGAGTGATAA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1589576Rnf14ring finger protein 14183013162730155686Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2312598Bp340Blood pressure QTL 3400.05arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)18130558703Rat
2300180Bmd67Bone mineral density QTL 674.80.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)18134291613Rat
2293661Bss50Bone structure and strength QTL 504.640.0003lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)18134291613Rat
61388Bp2Blood pressure QTL 23.23arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)18135374722Rat
9589153Insul31Insulin level QTL 317.150.05blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)18142547119Rat
2299160Iddm35Insulin dependent diabetes mellitus QTL 352.79blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)18420794160377792Rat
2312568Glom21Glomerulus QTL 2120.005kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)18518585840503530Rat
2293708Bss46Bone structure and strength QTL 468.80.0001lumbar vertebra morphology trait (VT:0010494)lumbar vertebra cortical cross-sectional area (CMO:0001690)181179151863636873Rat
1578661Bss20Bone structure and strength QTL 203.7femur morphology trait (VT:0000559)femoral neck cross-sectional area (CMO:0001697)181179151883218561Rat
1578667Bss21Bone structure and strength QTL 213.5femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)181179151883218561Rat
61382Bp46Blood pressure QTL 4618.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194179131393320Rat
631264Scl22Serum cholesterol level QTL 226.2blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)181194179131393320Rat
1331766Bp236Blood pressure QTL 2363.022arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181194429931359530Rat
61375Bp41Blood pressure QTL 412.4blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)181194429941122201Rat
1331753Bp231Blood pressure QTL 2313.643arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194429952293055Rat
1358358Sradr6Stress Responsive Adrenal Weight QTL 62.49adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)181194429959330563Rat
6903359Bp355Blood pressure QTL 3553.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)181194454459796478Rat
2313082Bss85Bone structure and strength QTL 850.80.0001long bone metaphysis morphology trait (VT:0000133)tibia midshaft total cross-sectional area (CMO:0001715)181495133759951337Rat
1358193Emca2Estrogen-induced mammary cancer QTL 21.6mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)181800759963571040Rat
1331735Rf44Renal function QTL 442.981urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)181823456431359530Rat
1331775Bp235Blood pressure QTL 2353.201arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)181823456431359530Rat
1600373Mamtr6Mammary tumor resistance QTL 6mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)181927890183218561Rat
1331741Bp232Blood pressure QTL 2323.59112arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)182137289383213037Rat
1641923Colcr8Colorectal carcinoma resistance QTL 83.10.0014intestine integrity trait (VT:0010554)poorly differentiated malignant colorectal tumor number (CMO:0002076)182206624252293055Rat
1331733Bp233Blood pressure QTL 2333.97196arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182479697779788953Rat
2325839Bp348Blood pressure QTL 3480.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182557098570570985Rat
12904673Cm127Cardiac mass QTL 1270.005heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)182654808246969551Rat
12904675Am19Aortic mass QTL 190.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)182654808246969551Rat
12904677Kidm72Kidney mass QTL 720.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)182654808246969551Rat
12904668Bw188Body weight QTL 1880.03body mass (VT:0001259)body weight (CMO:0000012)182654808246969551Rat
12904669Cm125Cardiac mass QTL 1250.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)182654808246969551Rat
12904670Cm126Cardiac mass QTL 1260.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)182654808246969551Rat
2301413Bp318Blood pressure QTL 3180.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182654808246969551Rat
2293704Bss35Bone structure and strength QTL 354.590.0002femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)182896485373964853Rat
2300157Bmd66Bone mineral density QTL 6613.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)182896485373964853Rat
2300177Bmd65Bone mineral density QTL 6519.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)182896485373964853Rat
9589816Gluco68Glucose level QTL 687.250.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)182979296574792965Rat
8694378Bw157Body weight QTL 1573.590.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)182979296574792965Rat
9590318Scort22Serum corticosterone level QTL 227.640.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)182979296574792965Rat
1331754Bp230Blood pressure QTL 2304.61609arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)182979296574792965Rat
738005Anxrr11Anxiety related response QTL 113.4exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)183003981375039813Rat
2290452Scl56Serum cholesterol level QTL 562.26blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)3191609953Rat
10401810Kidm53Kidney mass QTL 53kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)3822719447233430Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)31077870450302886Rat
70191BpQTLcluster4Blood pressure QTL cluster 43arterial blood pressure trait (VT:2000000)absolute change in systolic blood pressure (CMO:0000607)31077870450302886Rat
1358905Hrtrt17Heart rate QTL 175.90.000014heart pumping trait (VT:2000009)heart rate (CMO:0000002)31086191289878372Rat
1358885Bp251Blood pressure QTL 2513.8arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
1358888Bp264Blood pressure QTL 2644.43arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)314489145121056321Rat
2298542Neuinf11Neuroinflammation QTL 113.9nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)31500542276927699Rat
631676Cm8Cardiac mass QTL 87.030.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)31695470861954708Rat
731172Bp151Blood pressure QTL 1510.04arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)31831145447233430Rat
12879849Bw180Body weight QTL 1800.037body mass (VT:0001259)body weight (CMO:0000012)31831145447233430Rat
12879850Cm91Cardiac mass QTL 910.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)31831145447233430Rat
12879851Cm92Cardiac mass QTL 920.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)31831145447233430Rat
12879852Cm93Cardiac mass QTL 930.001heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)31831145447233430Rat
12879853Am5Aortic mass QTL 50.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)31831145447233430Rat
12879854Kidm63Kidney mass QTL 630.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)31831145447233430Rat
10450804Scl70Serum cholesterol level QTL 704.70.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32071409065714090Rat
10450794Scl69Serum cholesterol level QTL 696.30.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)32071409065714090Rat
631832Sach1Saccharin preference QTL 12.70.02consumption behavior trait (VT:0002069)calculated saccharin drink intake volume (CMO:0001600)32749462144188411Rat
2313049Bss72Bone structure and strength QTL 722.60.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)32749462150302886Rat
2313076Bss74Bone structure and strength QTL 7420.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)32749462150302886Rat
2313079Bss73Bone structure and strength QTL 731.5tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)32749462150302886Rat
2313093Bmd77Bone mineral density QTL 772.20.0001tibia mineral mass (VT:1000283)compact volumetric bone mineral density (CMO:0001730)32749462150302886Rat
2313101Bmd76Bone mineral density QTL 763.60.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)32749462150302886Rat
2302055Pia30Pristane induced arthritis QTL 303.50.001blood autoantibody amount (VT:0003725)serum immunoglobulin M-type rheumatoid factor level relative to an arbitrary reference serum (CMO:0002111)32793691972936919Rat
9590286Uminl1Urine mineral level QTL 13.50.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)32824968773249687Rat
8694196Abfw2Abdominal fat weight QTL 216.580.001visceral adipose mass (VT:0010063)abdominal fat pad weight to body weight ratio (CMO:0000095)32824968773249687Rat
8694386Bw159Body weight QTL 1594.520.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)32824968773249687Rat
8552950Pigfal12Plasma insulin-like growth factor 1 level QTL 127.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)32824968773249687Rat
9590136Scort3Serum corticosterone level QTL 323.370.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)32824968773249687Rat
2303593Gluco46Glucose level QTL 463blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)32846857173468571Rat
1354590Despr11Despair related QTL 110.000031locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)32846857173468571Rat
737818Hcar12Hepatocarcinoma resistance QTL 122.6liver integrity trait (VT:0010547)volume of individual liver tumorous lesion (CMO:0001078)329463235118376539Rat
61419Cia11Collagen induced arthritis QTL 115.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)33035677398535386Rat
61356Bp37Blood pressure QTL 373blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)33068464275684642Rat
631647Bp122Blood pressure QTL 1226.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)33068464275684642Rat
70216Cm14Cardiac mass QTL 142.1heart mass (VT:0007028)heart wet weight (CMO:0000069)331172320163586636Rat
11565451Bw177Body weight QTL 1770.002body mass (VT:0001259)body weight (CMO:0000012)33142640370668733Rat
11565452Kidm57Kidney mass QTL 570.001kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)33142640370668733Rat
12879866Cm94Cardiac mass QTL 940.001heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)33142640370668733Rat
12879867Cm95Cardiac mass QTL 950.047heart right ventricle mass (VT:0007033)heart right ventricle weight to body weight ratio (CMO:0000914)33142640370668733Rat
12879868Am6Aortic mass QTL 60.001aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)33142640370668733Rat
2301400Cm68Cardiac mass QTL 680.001heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)33142640370668733Rat
1300169Bp177Blood pressure QTL 1772.96arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)33370334761017857Rat
1354589Bw31Body weight QTL 313.3body mass (VT:0001259)body weight (CMO:0000012)33370334778196190Rat
1354604Bw36Body weight QTL 362.9body mass (VT:0001259)body weight (CMO:0000012)333703347104104347Rat
10450852Stl33Serum triglyceride level QTL 333.40.05blood LDL triglyceride amount (VT:0010699)blood lipoprotein triglyceride level (CMO:0002685)33819223350749747Rat
10450816Scl75Serum cholesterol level QTL 754.40.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)33819223350749747Rat
10450813Scl74Serum cholesterol level QTL 745.80.001blood LDL cholesterol amount (VT:0000181)blood low density lipoprotein cholesterol level (CMO:0000053)33819223350749747Rat
1358362Srcrt2Stress Responsive Cort QTL 22.78blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)338192233133483320Rat
738019Anxrr10Anxiety related response QTL 103.9exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)33851780383517803Rat
4889975Bmd81Bone mineral density QTL 814.3tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)33871036550302886Rat
634317Bw117Body weight QTL 1173.58abdominal fat pad mass (VT:1000711)abdominal fat pad weight to body weight ratio (CMO:0000095)33945463753296578Rat
2302276Bw82Body weight QTL 824.32body mass (VT:0001259)body weight (CMO:0000012)33945463762951183Rat
1331777Bw24Body weight QTL 243.503body mass (VT:0001259)body weight (CMO:0000012)33945463789115240Rat
1331795Rf30Renal function QTL 303.708urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)33945463789115240Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 619577 UniSTS
UniSTS 213153 UniSTS