RH129450 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH129450

Symbol: RH129450
Previously known as: AA964263; 
RGD ID: 5042464
Expected Size: 182 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.27848,222 - 848,392 (+)MAPPERmRatBN7.2
mRatBN7.28121,339,344 - 121,339,526 (+)MAPPERmRatBN7.2
Rnor_6.08130,313,189 - 130,313,370NCBIRnor6.0
Rnor_6.072,837,279 - 2,837,448NCBIRnor6.0
Rnor_5.072,815,743 - 2,815,912UniSTSRnor5.0
Rnor_5.08129,496,624 - 129,496,805UniSTSRnor5.0
RGSC_v3.471,710,492 - 1,710,661UniSTSRGSC3.4
Celera7721,718 - 721,887UniSTS
Celera8120,474,237 - 120,474,418UniSTS
Cytogenetic Map7q11UniSTS
Is Marker For: Genes:   Vipr1   Rnf41  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GGATAAACAATATGTCAAGACGG
Reverse Primer AACAGAGAAGGAAAGTCCTGGT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3961Vipr1vasoactive intestinal peptide receptor 18121303739121339587Rat
1309557Rnf41ring finger protein 417838160876869Rat

Nucleotide Sequences
RefSeq Transcripts NM_012685 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide BC087136 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1554321Bmd3Bone mineral density QTL 37.90.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)840952565123900184Rat
2300181Bmd55Bone mineral density QTL 555.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)876468691121468691Rat
61437Cia6Collagen induced arthritis QTL 6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)882460758122812818Rat
738011Anxrr9Anxiety related response QTL 96.1exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)893535351123900184Rat
1358893Bp263Blood pressure QTL 2635.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)893965141123900184Rat
1358903Bp252Blood pressure QTL 25270.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)893965141123900184Rat
738014Anxrr15Anxiety related response QTL 153.60.005locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)895718998123900184Rat
2300182Bmd56Bone mineral density QTL 565.4femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)895718998123900184Rat
2298550Neuinf6Neuroinflammation QTL 63.3nervous system integrity trait (VT:0010566)spinal cord RT1-B protein level (CMO:0002132)7127829089Rat
7411566Bw136Body weight QTL 13610.40.001body mass (VT:0001259)body weight gain (CMO:0000420)7131962314Rat
9590142Scort5Serum corticosterone level QTL 524.40.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)7131962314Rat
724560Plsm3Polydactyly-luxate syndrome (PLS) morphotypes QTL 30.0003tibia length (VT:0004357)tibia length (CMO:0000450)7134000259Rat
2317047Wbc4White blood cell count QTL 40.01leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)7135342956Rat
61410Bw19Body weight QTL 196.20.001body mass (VT:0001259)body weight (CMO:0000012)7144782185Rat
631503Bp102Blood pressure QTL 1021.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7144822433Rat
1300176Hrtrt10Heart rate QTL 103.19heart pumping trait (VT:2000009)heart rate (CMO:0000002)766427026029351Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 24875 UniSTS
  362814 UniSTS
UniSTS 212756 UniSTS