RH128375 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models   new Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Marker: RH128375

Symbol: RH128375
Previously known as: AA899590; 
RGD ID: 5040598
Expected Size: 198 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21923,879,602 - 23,879,800 (-)MAPPERmRatBN7.2
mRatBN7.2641,346,372 - 41,346,570 (+)MAPPERmRatBN7.2
Rnor_6.0643,890,417 - 43,890,614NCBIRnor6.0
Rnor_6.01925,393,828 - 25,394,025NCBIRnor6.0
Rnor_5.01936,370,006 - 36,370,203UniSTSRnor5.0
Rnor_5.0660,761,950 - 60,762,147UniSTSRnor5.0
Celera1923,428,502 - 23,428,699UniSTS
Celera640,633,240 - 40,633,437UniSTS
Cytogenetic Map6q16UniSTS
Is Marker For: Genes:   Rrm2   Rrm2l1  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AACTCGCTAGGTGAATTCTGGC
Reverse Primer TGACCATACCTGGCTTTACCTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1598310Rrm2ribonucleotide reductase regulatory subunit M264133985841346774Rat
2323655Rrm2l1ribonucleotide reductase regulatory subunit M2 like 1192387938323881961Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2293709Bss23Bone structure and strength QTL 235.180.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)6142487980Rat
2293650Bss31Bone structure and strength QTL 315.050.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)6142487980Rat
2293656Bss28Bone structure and strength QTL 286.790.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)6142487980Rat
7411584Foco4Food consumption QTL 44.30.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)6142838846Rat
738024Sach5Saccharine consumption QTL 53.90.00039consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)6143394190Rat
2301972Bp325Blood pressure QTL 3254.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)6172227641Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)6507449754641141Rat
4145119Mcs25Mammary carcinoma susceptibility QTL 250.0001mammary gland integrity trait (VT:0010552)ratio of deaths to total study population during a period of time (CMO:0001023)610894415110548006Rat
1578665Bss16Bone structure and strength QTL 164.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)61173566972593685Rat
1578668Bmd14Bone mineral density QTL 143.8femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)61173566972593685Rat
10401812Kidm54Kidney mass QTL 54kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
10401800Kidm49Kidney mass QTL 49kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61436878859368788Rat
1576309Emca7Estrogen-induced mammary cancer QTL 74mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)615107216107351382Rat
2292589Emca10Estrogen-induced mammary cancer QTL 100.048mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)61653614061536140Rat
1354664Slep2Serum leptin concentration QTL 24.49blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)61653614071636405Rat
1641898Colcr4Colorectal carcinoma resistance QTL43.710.0007intestine integrity trait (VT:0010554)well differentiated malignant colorectal tumor surface area measurement (CMO:0002077)62033877762613667Rat
2293839Kiddil2Kidney dilation QTL 24.8kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62086642281133036Rat
2293841Kiddil4Kidney dilation QTL 44.4kidney pelvis morphology trait (VT:0004194)hydronephrosis severity score (CMO:0001208)62086642281133036Rat
1331779Rf38Renal function QTL 382.876kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)63207442872227641Rat
634318Bw118Body weight QTL 1183.55abdominal fat pad mass (VT:1000711)abdominal fat pad weight (CMO:0000088)63330954957730294Rat
6893340Cm77Cardiac mass QTL 770.260.57heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)63330954981132889Rat
1300143Rf14Renal function QTL 142.92renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)63443413777102317Rat
1354632Scl29Serum cholesterol level QTL 293.74blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)63509870971636405Rat
634307Bp141Blood pressure QTL 1414arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)63523041780230417Rat
70199Coreg1Compensatory renal growth QTL 111.8kidney mass (VT:0002707)compensatory renal growth score (CMO:0001894)63569161857730540Rat
9590290Uminl2Urine mineral level QTL 23.960.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)63878398983783989Rat
9590306Scort18Serum corticosterone level QTL 182.880.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)63878398983783989Rat
9590140Scort4Serum corticosterone level QTL 414.490.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)63878398983783989Rat
7411590Foco7Food consumption QTL 76.80.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)19124688055Rat
10054132Srcrt9Stress Responsive Cort QTL 92.870.0017blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)19127355345Rat
631678Cm9Cardiac mass QTL 94.270.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)19128982497Rat
631681Cm12Cardiac mass QTL 123.330.00053heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)19128982497Rat
1549847Bss8Bone structure and strength QTL 84lumbar vertebra strength trait (VT:0010574)vertebra ultimate force (CMO:0001678)19131963836Rat
9590298Uminl5Urine mineral level QTL 53.590.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)19136824771Rat
8552935Pigfal10Plasma insulin-like growth factor 1 level QTL 105.7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)19136824771Rat
9590250Scort11Serum corticosterone level QTL 1123.450.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)19136824771Rat
9590090Insglur8Insulin/glucose ratio QTL 810.810.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)19136824771Rat
9589102Slep13Serum leptin concentration QTL 134.630.001blood leptin amount (VT:0005667)plasma leptin level (CMO:0000781)1956937445569374Rat
8694186Bw152Body weight QTL 1523.340.001body mass (VT:0001259)body weight gain (CMO:0000420)1956937445569374Rat
7247442Uae39Urinary albumin excretion QTL 39urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)19218792746708701Rat
724566Uae12Urinary albumin excretion QTL 125urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19218792756457239Rat
61447Tcas1Tongue tumor susceptibility QTL 16.08tongue integrity trait (VT:0010553)squamous cell carcinoma of the tongue maximum tumor diameter (CMO:0001875)19231612147316121Rat
2317848Alcrsp21Alcohol response QTL 211.8999999761581420.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)19320477748204777Rat
1331737Uae29Urinary albumin excretion QTL 295.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19409615555283277Rat
724518Uae19Urinary albumin excretion QTL 195.5urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)19745724942983518Rat
724565Tcas5Tongue tumor susceptibility QTL 510.04tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)19997775339654489Rat
61423Cia14Collagen induced arthritis QTL 143joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)191082797043544039Rat
61407Scl12Serum cholesterol level QTL 120.001blood HDL cholesterol amount (VT:0000184)serum high density lipoprotein cholesterol level (CMO:0000361)191392640130303727Rat
1558656Prcs1Prostate cancer susceptibility QTL 15prostate integrity trait (VT:0010571)percentage of study population developing ventral prostate tumorous lesions during a period of time (CMO:0000943)191511459834521833Rat
7411549Bw130Body weight QTL 13050.001body mass (VT:0001259)body weight gain (CMO:0000420)191545586057337602Rat
1331788Rf45Renal function QTL 452.818kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)191560502346559041Rat
1578764Stresp19Stress response QTL 193.60.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)191563020157337602Rat
2298478Eau8Experimental allergic uveoretinitis QTL 80.0163uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)191715443357337602Rat
61350Bp32Blood pressure QTL 320.012arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)192048357557337602Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100359539 UniSTS
  362720 UniSTS
UniSTS 211683 UniSTS