RH128142 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH128142

Symbol: RH128142
Previously known as: AA866385; 
RGD ID: 5040192
Expected Size: 191 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2812,124,084 - 12,124,275 (+)MAPPERmRatBN7.2
Rnor_6.0813,838,795 - 13,838,985NCBIRnor6.0
Rnor_5.0813,778,325 - 13,778,515UniSTSRnor5.0
RGSC_v3.4812,085,202 - 12,085,392UniSTSRGSC3.4
Celera813,591,806 - 13,591,996UniSTS
RH 3.4 Map8116.7UniSTS
Cytogenetic Map8q12UniSTS
Is Marker For: Genes:   C8h11orf54  


Annotation


References - curated
# Reference Title Reference Citation
1. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCACCACACACTAACCATCAACA
Reverse Primer CTTGTGCCTCCTATTGAAACCC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1309534C8h11orf54similar to human chromosome 11 open reading frame 5481212383912146412Rat



QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
9590084Insglur5Insulin/glucose ratio QTL 518.540.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)8124597739Rat
2317882Alcrsp24Alcohol response QTL 243.20.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)8125902202Rat
12880023Bw184Body weight QTL 1840.001body mass (VT:0001259)body weight (CMO:0000012)8209764047097640Rat
12880025Cm102Cardiac mass QTL 1020.044heart mass (VT:0007028)heart wet weight to body weight ratio (CMO:0002408)8209764047097640Rat
12880028Cm103Cardiac mass QTL 1030.02heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)8209764047097640Rat
12880044Am9Aortic mass QTL 90.007aorta mass (VT:0002845)aorta weight to aorta length to body weight ratio (CMO:0002722)8209764047097640Rat
2317032Ginf2Gastrointestinal inflammation QTL 23.210.005liver integrity trait (VT:0010547)liver granuloma severity score (CMO:0002157)8470581049705810Rat
2317036Livw3Liver weight QTL 32.430.01liver mass (VT:0003402)liver weight to body weight ratio (CMO:0000633)8470581049705810Rat
2317048Ginf1Gastrointestinal inflammation QTL 13.520.005cecum mucosa thickness (VT:0010234)enterocolitis severity score (CMO:0002138)8470581049705810Rat
2301416Bp315Blood pressure QTL 3150.008arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)8767057852670578Rat
1354595Despr4Despair related QTL 42.160.0036locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)8768895552688955Rat
1354627Despr14Despair related QTL 140.0056locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)8768895552688955Rat
1581557Eae16Experimental allergic encephalomyelitis QTL 163.8nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)88462195110921472Rat
2317030Wbc5White blood cell count QTL 53.210.005leukocyte quantity (VT:0000217)white blood cell count (CMO:0000027)8873663553736635Rat
2317051Aia18Adjuvant induced arthritis QTL 182.42joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)8873663553736635Rat
1598824Memor4Memory QTL 42.5exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)8971222053356647Rat
1357398Slep3Serum leptin concentration QTL 33.43blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)8971246341866876Rat
2302367Slep5Serum leptin concentration QTL 53.43blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)8971246341866876Rat
631650Stl6Serum triglyceride level QTL 640.0019blood triglyceride amount (VT:0002644)plasma triglyceride level (CMO:0000548)810378157112202585Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 363016 UniSTS
UniSTS 211450 UniSTS